
ID   FM164942; SV 1; linear; genomic DNA; STD; HUM; 968 BP.
AC   FM164942;
DT   17-JUN-2008 (Rel. 96, Created)
DT   13-JAN-2009 (Rel. 99, Last updated, Version 2)
DE   Homo sapiens partial HLA-C gene for MHC class I antigen, HLA-Cw*02new
DE   allele, exons 2-3
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-968
RA   Rowlands J.;
RT   ;
RL   Submitted (05-JUN-2008) to the INSDC.
RL   Rowlands J., Immunogenetics, Welsh Transplantation and Immunogenetics,
RL   Welsh Blood Service, Ely Valley Road, Talbot Green, Pontyclun, CF72 9WB,
RN   [2]
RX   DOI; 10.1111/j.1399-0039.2008.01159.x.
RX   PUBMED; 19017302.
RA   Johnson J., Street J., Hammond L., Iley C., Darke C.;
RT   "Two new HLA-C alleles: Cw*0222 and Cw*0434";
RL   Tissue Antigens 73(1):76-78(2009).
DR   MD5; 16fe08af94d1c480b581b10233b6923b.
FH   Key             Location/Qualifiers
FT   source          1..968
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /sub_species="Human"
FT                   /isolate="41873"
FT                   /mol_type="genomic DNA"
FT                   /country="Senegal"
FT                   /cell_type="mixed leucocytes"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: 5CwEx1-28TCC, fwd_seq:
FT                   gcgccccgarccctcc, rev_name: 3CwIn3-1232ggg, rev_seq:
FT                   tggtcaaagtggtcaaaggg"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<32..301,547..>822)
FT                   /codon_start=3
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*02new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presentation"
FT                   /db_xref="IMGT/HLA:C*02:22"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="UniProtKB/TrEMBL:B3W6H2"
FT                   /protein_id="CAQ60109.1"
FT                   VEWLRRYLENGKETLQRA"
FT   exon            32..301
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*02new"
FT                   /number=2
FT   intron          302..546
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*02new"
FT                   /number=2
FT   exon            547..822
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*02new"
FT                   /number=3
SQ   Sequence 968 BP; 179 A; 310 C; 336 G; 143 T; 0 other;
     cgggcgggtc tcagcccctc ctctccccca ggctcccact ccatgaggta tttctacacc        60
     gctgtgtccc ggcccagccg cggagagccc cacttcatcg cagtgggcta cgtggacgac       120
     acgcagttcg tgcggttcga cagcgacgcc gcgagtccaa gaggggagcc gcgggcgccg       180
     tgggtggagc aggaggggcc ggagtattgg gaccgggaga cacagaagta caagcgccag       240
     gcacagactg accgagtgaa cctgcggaaa ctgcgcggct actacaacca gagcgaggcc       300
     ggtgagtgac cccggcccgg ggcgcaggtc acgacccctc cccatccccc acggacggcc       360
     cgggtcgccc cgagtctccg ggtctgagat ccaccccgag gctgcggaac ccgcccagac       420
     cctcgaccgg agagagcccc agtcaccttt acccggtttc attttcagtt taggccaaaa       480
     tccccgcggg ttggtcgggg ctggggcggg gctcggggga cgggctgacc acgggggcgg       540
     ggccagggtc tcacaccctc cagaggatgt acggctgcga cctggggccc gacgggcgcc       600
     tcctccgcgg gtataaccag ttcgcctacg acggcaagga ttacatcgcc ctgaatgagg       660
     acctgcgctc ctggaccgcc gcggacacag cggctcagat cacccagcgc aagtgggagg       720
     cggcccgtga ggcggagcag tggagagcct acctggaggg cgagtgcgtg gagtggctcc       780
     gcagatacct ggagaacggg aaggagacgc tgcagcgcgc gggtaccagg ggcagtgggg       840
     agccttcccc atctcctgta gatctcccgg gatggcctcc cacgaggagg ggaggaaaat       900
     gggatcagcg ctagaatatc gccctccctt gaatggagaa tgggatgagt tttcctgagt       960
     ttcctctg                                                                968