
ID   FM164941; SV 1; linear; genomic DNA; STD; HUM; 962 BP.
AC   FM164941;
DT   17-JUN-2008 (Rel. 96, Created)
DT   13-JAN-2009 (Rel. 99, Last updated, Version 2)
DE   Homo sapiens partial HLA-C gene for MHC class I antigen, HLA-Cw*04 new
DE   allele, exons 2-3
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-962
RA   Rowlands J.;
RT   ;
RL   Submitted (05-JUN-2008) to the INSDC.
RL   Rowlands J., Immunogenetics, Welsh Transplantation and Immunogenetics,
RL   Welsh Blood Service, Ely Valley Road, Talbot Green, Pontyclun, CF72 9WB,
RN   [2]
RX   DOI; 10.1111/j.1399-0039.2008.01159.x.
RX   PUBMED; 19017302.
RA   Johnson J., Street J., Hammond L., Iley C., Darke C.;
RT   "Two new HLA-C alleles: Cw*0222 and Cw*0434";
RL   Tissue Antigens 73(1):76-78(2009).
DR   MD5; 1617b3edc4562581654a55e12da15a14.
FH   Key             Location/Qualifiers
FT   source          1..962
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /sub_species="Human"
FT                   /isolate="41718"
FT                   /mol_type="genomic DNA"
FT                   /country="Senegal"
FT                   /cell_type="mixed leucocytes"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: 5CwEx1-28TCC, fwd_seq:
FT                   gcgccccgarccctcc, rev_name: Cw3'In3-290, rev_seq:
FT                   cagctgctgcagtggtcaaa"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<26..295,542..>817)
FT                   /codon_start=3
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*04 new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presentation"
FT                   /db_xref="IMGT/HLA:C*04:34"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:B3W6H1"
FT                   /protein_id="CAQ60108.1"
FT                   VEWLRRYLENGKETLQRA"
FT   exon            26..295
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*04 new"
FT                   /number=2
FT   intron          296..541
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*04 new"
FT                   /number=2
FT   exon            542..817
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*04 new"
FT                   /number=3
SQ   Sequence 962 BP; 175 A; 308 C; 332 G; 147 T; 0 other;
     ggtctcagcc actcctcgtc cccaggctcc cactccatga ggtatttctc cacatccgtg        60
     tcctggcccg gccgcgggga gccccgcttc atcgcagtgg gctacgtgga cgacacgcag       120
     ttcgtgcggt tcgacagcga cgccgcgagt ccaagagggg agccgcggga gccgtgggtg       180
     gagcaggagg ggccggagta ttgggaccgg gagacacaga agtacaagcg ccaggcacag       240
     gctgaccgag tgaacctgcg gaaactgcgc ggctactaca accagagcga ggacggtgag       300
     tgaccccggc ccggggcgca ggtcacgacc cctccccatc ccccacggac ggcccgggtc       360
     gccccgagtc tccccgtctg agatccaccc cgaggctgcg gaacccgccc agaccctcga       420
     ccggagagag ccccagtcac ctttacccgg tttcattttc agtttaggcc aaaatccccg       480
     cgggttggtc gggactgggg cggggctcgg gggaccgggc tgaccacggg ggcggggcca       540
     gggtctcaca ccctccagag gatgtttggc tgcgacctgg ggccggacgg gcgcctcctc       600
     cgcgggtata accagttcgc ctacgacggc aaggattaca tcgccctgaa cgaggatctg       660
     cgctcctgga ccgccgcgga cacggcggct cagatcaccc agcgcaagtg ggaggcggcc       720
     cgtgtggcgg agcagctgag agcctacctg gagggcctgt gcgtggagtg gctccgcaga       780
     tacctggaga acgggaagga gacgctgcag cgcgcgggta ccaggggcag tggggagcct       840
     tccccatctc ccgtagatct cccgggatgg cctcccacga ggaggggagg aaaatgggat       900
     cagcgctaga atatcgccct cccttgaatg gagaatggga tgagttttcc tgagtttcct       960
     ct                                                                      962