
EBI Dbfetch

ID   FM161906; SV 1; linear; genomic DNA; STD; HUM; 1049 BP.
AC   FM161906;
DT   29-MAY-2008 (Rel. 95, Created)
DT   29-MAY-2008 (Rel. 95, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*40SH allele,
DE   exons 2-3
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1049
RA   Rowlands J.;
RT   ;
RL   Submitted (20-MAY-2008) to the INSDC.
RL   Rowlands J., Immunogenetics, Welsh Transplantation and Immunogenetics,
RL   Welsh Blood Service, Ely Valley Road, Talbot Green, Pontyclun, CF72 9WB,
RN   [2]
RA   Hammond L., Rowlands J., Johnson J., Darke C.;
RT   "A novel HLA-B*40 allele";
RL   Unpublished.
DR   MD5; 0816f2993bd1c4d6228d7236b8868324.
FH   Key             Location/Qualifiers
FT   source          1..1049
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: BE1c, fwd_seq: cctcctgctgctctcggc,
FT                   rev_name: 3BIn3-108, rev_seq: attctccattcaagggagggcgac"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<159..428,674..>949)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40SH"
FT                   /product="MHC class 1 antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:B3GV27"
FT                   /db_xref="IMGT/HLA:B*40:92"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:B3GV27"
FT                   /protein_id="CAQ55956.1"
FT                   VEWLRRYLENGKETLQRA"
FT   exon            <159..428
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40SH"
FT                   /number=2
FT   intron          429..673
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40SH"
FT                   /number=2
FT   exon            674..949
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40SH"
FT                   /number=3
SQ   Sequence 1049 BP; 185 A; 340 C; 388 G; 136 T; 0 other;
     cggccctggc cctgaccgag acctgggccg gtgagtgcgg gtcggcaggg aaatggcctc        60
     tgtggggagg agcgagggga ccgcaggcgg gggcgcagga cccggggagc cgcgccggga       120
     ggagggtcgg gcgggtctca gctcctcctc gcccccaggc tcccactcca tgaggtattt       180
     ccacaccgcc atgtcccggc ccggccgcgg ggagccccgc ttcatcaccg tgggctacgt       240
     ggacgacacg ctgttcgtga ggttcgacag cgacgccacg agtccgagga aggagccgcg       300
     ggcgccatgg atagagcagg aggggccgga gtattgggac cgggagacac agatctccaa       360
     gaccaacaca cagacttacc gagagagcct gcggaacctg cgcggctact acaaccagag       420
     cgaggccggt gagtgacccc ggcccggggc gcaggtcacg actccccatc ccccacgtac       480
     ggcccgggtc gccccgagtc tccgggtccg agatccgacc ccctgaggcc gcgggacccg       540
     cccagaccct cgaccggcga gagccccagg cgcgtttacc cggtttcatt ttcagttgag       600
     gccaaaatcc ccgcgggttg gtcggggcgg ggcggggctc gggggactgg gctgaccgcg       660
     gggccggggc cagggtctca caccctccag aggatgtacg gctgcgacgt ggggccggac       720
     gggcgcctcc tccgcgggca taaccagtac gcctacgacg gcaaggatta catcgccctg       780
     aacgaggacc tgcgctcctg gaccgccgcg gacacggcgg ctcagatctc ccagcgcaag       840
     ttggaggcgg cccgtgtggc ggagcagctg agagcctacc tggagggcct gtgcgtggag       900
     tggctccgca gatacctgga gaacgggaag gagacgctgc agcgcgcggg taccaggggc       960
     agtggggagc cttccccatc tcctataggt cgccggggat ggcctcccac gagaagagga      1020
     ggaaaatggg atcagcgcta gaatgtcgc                                        1049
