
ID   FM160944; SV 1; linear; genomic DNA; STD; HUM; 1923 BP.
AC   FM160944;
DT   27-MAY-2008 (Rel. 95, Created)
DT   27-MAY-2008 (Rel. 95, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*44New
DE   allele, exons 1-5
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1923
RA   Dormoy A.;
RT   ;
RL   Submitted (19-MAY-2008) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Soreau E., Bert S., Leinsebach R.;
RT   "The HLA-B*44New allele";
RL   Unpublished.
DR   MD5; 782447e92cdaff4c94b5b05e96159383.
FH   Key             Location/Qualifiers
FT   source          1..1923
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: P5' Ala C-1, fwd_seq:
FT                   ctgaccgagacctgggcc, rev_name: P3' Exon 5B, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..2,132..401,645..920,1496..1771,1865..>1923)
FT                   /codon_start=2
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*44New"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:B*44:64:02"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:B3GV26"
FT                   /protein_id="CAQ55764.1"
FT                   VPIVGIVAGLAVL"
FT   exon            <1..2
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*44New"
FT                   /number=1
FT   intron          3..131
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*44New"
FT                   /number=1
FT   exon            132..401
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*44New"
FT                   /number=2
FT   intron          402..644
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*44New"
FT                   /number=2
FT   exon            645..920
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*44New"
FT                   /number=3
FT   intron          921..1495
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*44New"
FT                   /number=3
FT   exon            1496..1771
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*44New"
FT                   /number=4
FT   intron          1772..1864
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*44New"
FT                   /number=4
FT   exon            1865..1923
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*44New"
FT                   /number=5
SQ   Sequence 1923 BP; 367 A; 593 C; 625 G; 338 T; 0 other;
     cggtgagtgc ggggtcggga gggaaatggc ctctgtgggg aggagagagg ggaccgcagg        60
     cgggggcgca ggacccgggg agccgcgccg ggaggagggt cgggcgggtc tcagcccctc       120
     ctcgccccca ggctcccact ccatgaggta tttctacacc gccatgtccc ggcccggccg       180
     cggggagccc cgcttcatca ccgtgggcta cgtggacgac acgctgttcg tgaggttcga       240
     cagcgacgcc acgagtccga ggaaggagcc gcgggcgcca tggatagagc aggaggggcc       300
     ggagtattgg gaccgggaga cacagatctc caagaccaac acacagactt accgagagaa       360
     cctgcgcacc gcgctccgct actacaacca gagcgaggcc ggtgagtgac cccggcccgg       420
     ggcgcaggtc acgactcccc atcccccacg tacggcccgg gtcgccccga gtctccgggt       480
     ccgagatccg cccccgaggc cgcgggaccc gcccagaccc tcgaccggcg agagccccag       540
     gcgcgtttac ccggtttcat tttcagttga ggccaaaatc cccgcgggtt ggtcggggcg       600
     gggcggggct cgggggacgg ggctgaccgc ggggccgggg ccagggtctc acatcatcca       660
     gaggatgtac ggctgcgacg tggggccgga cgggcgcctc ctccgcgggt atgaccagga       720
     cgcctacgac ggcaaggatt acatcgccct gaacgaggac ctgagctcct ggaccgcggc       780
     ggacaccgcg gctcagatca cccagcgcaa gtgggaggcg gcccgtgtgg cggagcagct       840
     gagagcctac ctggagggcg agtgcgtgga gtggctccgc agatacctgg agaacgggaa       900
     ggagacgctg cagcgcgcgg gtaccagggg cagtggggag ccttccccat ctcctatagg       960
     tcgccgggga tggcctccca cgagaagagg aggaaaatgg gatcagcgct agaatgtcgc      1020
     cctcccttga atggagaatg gcatgagttt tcctgagttt cctctgaggg ccccctcttc      1080
     tctctaggac aattaaggga tgacgtctct gaggaaatgg aggggaagac agtccctaga      1140
     atactgatca ggggtcccct ttgacccctg cagcagcctt gggaaccgtg acttttcctc      1200
     tcaggccttg ttctctgcct cacactcagt gtgtttgggg ctctgattcc agcacttctg      1260
     agtcacttta cctccactca gatcaggagc agaagtccct gttccccgct cagagactcg      1320
     aactttccaa tgaataggag attatcccag gtgcctgcgt ccaggctggt gtctgggttc      1380
     tgtgcccctt ccccacccca ggtgtcctgt ccattctcag gctggtcaca tgggtggtcc      1440
     tagggtgtcc catgagagat gcaaagcgcc tgaattttct gactcttccc atcagacccc      1500
     ccaaagacac atgtgaccca ccaccccatc tctgaccatg aggtcaccct gaggtgctgg      1560
     gccctgggct tctaccctgc ggagatcaca ctgacctggc agcgggatgg cgaggaccaa      1620
     actcaggaca ccgagcttgt ggagaccaga ccagcaggag atagaacctt ccagaagtgg      1680
     gcagctgtgg tggtgccttc tggagaagag cagagataca catgccatgt acagcatgag      1740
     gggctgccga agcccctcac cctgagatgg ggtaaggagg gggatgaggg gtcatatctc      1800
     ttctcaggga aagcaggagc ccttcagcag ggtcagggcc cctcatcttc ccttcctttc      1860
     ccagagccgt cttcccagtc caccgtcccc atcgtgggca ttgttgctgg cctggctgtc      1920
     cta                                                                    1923