
ID   FJ805838; SV 1; linear; genomic DNA; STD; HUM; 3260 BP.
AC   FJ805838;
DT   25-NOV-2009 (Rel. 102, Created)
DT   25-NOV-2009 (Rel. 102, Last updated, Version 1)
DE   Homo sapiens isolate CUI65-01 truncated MHC class I antigen (HLA-G) gene,
DE   HLA-G*01010301 allele, complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-3260
RX   DOI; 10.1111/j.1399-0039.2009.01363.x.
RX   PUBMED; 19845907.
RA   Cervera I., Herraiz M.A., Roman A., Vidart J., Martinez-Laso J.;
RT   "The novel HLA-G*01010302 allele differs from G*01010301 by a single
RT   nucleotide change in intron 5";
RL   Tissue Antigens 74(5):463-464(2009).
RN   [2]
RP   1-3260
RA   Cervera I., Roman A., Martinez-Laso J.;
RT   ;
RL   Submitted (04-MAR-2009) to the INSDC.
RL   Inmunoterapia Celular, ISCIII, Carretera de Majadahonda a Pozuelo Km 2,200,
RL   Majadahonda, Madrid 28220, Spain
DR   MD5; ef1a012a7555119c7d5c73f441ad3335.
DR   Ensembl-Gn; ENSG00000204632; homo_sapiens.
DR   Ensembl-Gn; ENSG00000206506; homo_sapiens.
DR   Ensembl-Gn; ENSG00000230413; homo_sapiens.
DR   Ensembl-Gn; ENSG00000233095; homo_sapiens.
DR   Ensembl-Gn; ENSG00000235346; homo_sapiens.
DR   Ensembl-Gn; ENSG00000235680; homo_sapiens.
DR   Ensembl-Gn; ENSG00000237216; homo_sapiens.
DR   Ensembl-Tr; ENST00000360323; homo_sapiens.
DR   Ensembl-Tr; ENST00000383621; homo_sapiens.
DR   Ensembl-Tr; ENST00000423011; homo_sapiens.
DR   Ensembl-Tr; ENST00000423373; homo_sapiens.
DR   Ensembl-Tr; ENST00000428701; homo_sapiens.
DR   Ensembl-Tr; ENST00000428952; homo_sapiens.
DR   Ensembl-Tr; ENST00000444098; homo_sapiens.
DR   Ensembl-Tr; ENST00000449127; homo_sapiens.
DR   Ensembl-Tr; ENST00000546545; homo_sapiens.
DR   Ensembl-Tr; ENST00000546634; homo_sapiens.
DR   Ensembl-Tr; ENST00000547241; homo_sapiens.
DR   Ensembl-Tr; ENST00000547931; homo_sapiens.
DR   Ensembl-Tr; ENST00000550897; homo_sapiens.
DR   Ensembl-Tr; ENST00000553052; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..3260
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /isolate="CUI65-01"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: ccaatgtggctgaacaaagg, rev_seq:
FT                   acaaccaggccagcaacg"
FT                   /PCR_primers="fwd_seq: cccacacagggcagctgtttca, rev_seq:
FT                   ggtacccgcgcgctgcagca"
FT                   /PCR_primers="fwd_seq: ctggttgtccttgcagctgta, rev_seq:
FT                   tgagacagagacggagacat"
FT                   /db_xref="taxon:9606"
FT   gene            1..3260
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT   mRNA            join(1..333,463..732,959..1234,1834..2109,2232..2348,
FT                   2794..2826,2969..3016,3184..3260)
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT                   /product="truncated MHC class I antigen"
FT   exon            1..333
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT                   /number=1
FT   5'UTR           1..260
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT   CDS             join(261..333,463..732,959..1234,1834..2109,2232..2348,
FT                   2794..2798)
FT                   /codon_start=1
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT                   /product="truncated MHC class I antigen"
FT                   /db_xref="GOA:Q6DU14"
FT                   /db_xref="IMGT/HLA:G*01:01:03:01"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="UniProtKB/TrEMBL:Q6DU14"
FT                   /protein_id="ACZ37195.1"
FT   exon            463..732
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT                   /number=2
FT   exon            959..1234
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT                   /number=3
FT   exon            1834..2109
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT                   /number=4
FT   exon            2232..2348
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT                   /number=5
FT   exon            2794..2826
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT                   /number=6
FT   exon            2969..3016
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT                   /number=7
FT   exon            3184..3260
FT                   /gene="HLA-G"
FT                   /allele="HLA-G*01010301"
FT                   /number=8
SQ   Sequence 3260 BP; 625 A; 943 C; 1001 G; 691 T; 0 other;
     gaagtcccag ggcctcaagc gtggctctca gggtctcagg ccccacaggc ggtgtatgga        60
     ttggggaggc cccgcgttgg ggattctctc ctccttctcc taacctgtgt cgggtccttc       120
     ttcctggata ctcaccgggc ggccccagtt ctcactccca ttaggtgaca ggtttttaga       180
     gaagccaatc agcgtcgccg cggtcctggt tctaaagtcc tcgctcaccc acccggactc       240
     attctcccca gacgccaagg atggtggtca tggcaccccg aaccctcttc ctgctactct       300
     cgggggccct gaccctgacc gagacctggg cgggtgagtg cggggtcagg agggaaacgg       360
     cccctgcgcg gaggagggag gggccggccc ggcgggggcg caggacccgg cagccgcgcc       420
     gggaggaggg tcgggcgggt ctcaacccct cctcgccccc aggctcccac tccatgaggt       480
     atttcagcgc cgccgtgtcc cggcccggcc gcggggagcc ccgcttcatc gccatgggct       540
     acgtggacga cacgcagttc gtgcggttcg acagcgactc ggcgtgtccg aggatggagc       600
     cgcgggcgcc gtgggtggag caggaggggc cagagtattg ggaagaggag acacggaaca       660
     ccaaggccca cgcacagact gacagaatga acctgcagac cctgcgcggc tactacaacc       720
     agagcgaggc cagtgagtaa ccccggccca gggcgcagat cacgaccccc cacctccatg       780
     ccccacggac gccccgggta ctcccgagtc tccgggtctg ggatccaccc cgaggccgcg       840
     ggacccgccc agaccctcta cctgggagaa ccccaggcgc ctttaccaaa atccctgcgg       900
     gtgggtccgg gcgagggcga ggctcggtgg gcggggctga ccgaaggggt ggggccaggt       960
     tctcacaccc tccagtggat gattggctgc gacctggggt ccgacggtcg cctcctccgc      1020
     gggtatgaac agtatgccta cgatggcaag gattacctcg ccctgaacga ggacctgcgc      1080
     tcctggaccg cagcggacac tgcggctcag atctccaagc gcaagtgtga ggcggccaat      1140
     gtggctgaac aaaggagagc ctacctggag ggcacgtgcg tggagtggct ccacagatac      1200
     ctggagaacg ggaaggagat gctgcagcgc gcgggtacca ggggcagtgg ggcgcctccc      1260
     tgatctcctg tagacctccc agcctggcct agcacaagga gaggaggaaa atgggaccaa      1320
     caccagaata tcgccctccc tctggtcctg agggagagga atcctcctgg gtttccagat      1380
     cctgtaccag agagtgattc tgagggcccg tcctgctctc tgggacaatt aagggatgaa      1440
     gtctctgagg gagtggaggg gaagacaatc cctggaggac tgatcagggg ttccctttga      1500
     ccccacagca gccttggcac caggactttt cccctcaggc cttgttctct gcctcacact      1560
     caatgtgtgt gggagtctga ctccagctcc tctgagtccc ttggcctcca ctcaggtcag      1620
     aaccagaggt ccctgctccc ccgctcagag actagaactt tccaaggaat aggagattat      1680
     cccaggtgcc cgtgtccagg ctggtgtctg ggttctgtgc tcccttcccc accccaggta      1740
     tctggttcat tcttaggatg gtcacatcca ggtgctgctg gagtgtccca tgagagatgc      1800
     aaagtgcttg agttttctga ctcttccttt cagacccccc caagacacac gtgacccacc      1860
     accctgtctt tgactatgag gccaccctga ggtgctgggc cctgggcttc taccctgcgg      1920
     agatcatact gacctggcag cgggatgggg aggaccagac ccaggacgtg gagctcgtgg      1980
     agaccaggcc tgcaggggat ggaaccttcc agaagtgggc agctgtggtg gtgccttctg      2040
     gagaggagca gagatacacg tgccatgtgc agcatgaggg gctgccggag cccctcatgc      2100
     tgagatggag taaggaggga gatggaggca tcatgtctgt tagggaaagc aggagcctct      2160
     ctgaagacct ttaacagggt cggtggtgag gcctgggggt cagagaccct caccttcacc      2220
     tcctttccca gagcagtctt ccctgcccac catccccatc atgggtatcg ttgctggcct      2280
     ggttgtcctt gcagctgtag tcactggagc tgcggtcgct gctgtgctgt ggaggaagaa      2340
     gagctcaggt aaggaagggg tgacaagtgg ggtctgagtt ttcttgtccc actgggggtt      2400
     tcaagcccca ggtagaagtg tgccctgcct ggttactggg aagcaccatc cacactcatg      2460
     ggcctaccca gcctgggccc tgtgtgccag caccttctct tttgtaaagc acctgtgaca      2520
     atgaaggaca gatttatcac cttgatgatt gtagtgatgg ggacctgatc ctagtaatca      2580
     caggtcaggg gaaggtccct ggctaaggac agaccttagg agggcagttg gtcgaggacc      2640
     cacatctgct ttccttgttt ttcctgatcc cgccctgagt ctgcagtcac acatttctgg      2700
     aaacttctcg agggtccaag actaggaggt tcctctagga cctcatggcc ctgccacctt      2760
     tctggcctct cacaggacat tttcttccca cagattgaaa aggagggagc tactctcagg      2820
     ctgcaagtaa gtatgaagga ggctgatccc tgagatcctt gggatcttgt gtttgggagc      2880
     ccatggggga gctcacccac cccacaattc ctcctctggc cacatctcct gtggtctctg      2940
     accaggtgct gtttttgttc tactctaggc agtgacagtg cccagggctc taatgtgtct      3000
     ctcacggctt gtaaatgtga caccccgggg ggcctgatgt gtgtgggttg ttgaggggaa      3060
     cagtggacat agctgtgcta tgaggtttct ttgacttgaa tgtattgagc atgtgatggg      3120
     ctgtttaaag tgtcacccct cactgtgact gatatgaatt tgttcatgaa tatttttctg      3180
     tagtgtgaaa cagctgccct gtgtgggact gagtggcaag tccctttgtg acttcaagaa      3240
     ccctgacttc tctttctgca                                                  3260