
EBI Dbfetch

ID   FJ785736; SV 1; linear; genomic DNA; STD; HUM; 4537 BP.
AC   FJ785736;
DT   29-MAR-2009 (Rel. 100, Created)
DT   29-MAR-2009 (Rel. 100, Last updated, Version 1)
DE   Homo sapiens MHC class I antigen (HLA-Cw) gene, HLA-Cw-Cw*140201 allele,
DE   promoter region and complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-4537
RA   Xu Y., Deng Z., Yang B.;
RT   "HLA-Cw full length cloning and sequencing: Sequence analysis from 5'
RT   upstream region through 3' downstream region";
RL   Unpublished.
RN   [2]
RP   1-4537
RA   Xu Y., Deng Z., Yang B.;
RT   ;
RL   Submitted (24-FEB-2009) to the INSDC.
RL   Immunogenetic Laboratory, Shenzhen Blood Center, 2# Meigang South Street,
RL   Nigang West Road, Shenzhen, Guangdong 518035, China
DR   MD5; e399f6b5b942e40aa05e7560a86bbc92.
FH   Key             Location/Qualifiers
FT   source          1..4537
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: CwF, fwd_seq:
FT                   cgcaactttgaggtgatgact, rev_name: CwR, rev_seq:
FT                   ttgtctcagaaagcacaggga"
FT                   /db_xref="taxon:9606"
FT   gene            1..4537
FT                   /gene="HLA-Cw"
FT                   /allele="Cw*140201"
FT   misc_feature    1..961
FT                   /gene="HLA-Cw"
FT                   /allele="Cw*140201"
FT                   /note="contains promoter and 5' UTR"
FT   mRNA            join(<962..1034,1165..1434,1681..1956,2544..2819,
FT                   2941..3060,3500..3532,3640..3687,3852..4537)
FT                   /gene="HLA-Cw"
FT                   /allele="Cw*140201"
FT                   /product="MHC class I antigen"
FT   CDS             join(962..1034,1165..1434,1681..1956,2544..2819,2941..3060,
FT                   3500..3532,3640..3687,3852..3856)
FT                   /codon_start=1
FT                   /gene="HLA-Cw"
FT                   /allele="Cw*140201"
FT                   /product="MHC class I antigen"
FT                   /note="glycoprotein"
FT                   /db_xref="GOA:C1K0Y4"
FT                   /db_xref="IMGT/HLA:C*14:02:01"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR010579"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:C1K0Y4"
FT                   /protein_id="ACN97202.1"
FT   3'UTR           3857..4537
FT                   /gene="HLA-Cw"
FT                   /allele="Cw*140201"
SQ   Sequence 4537 BP; 924 A; 1242 C; 1360 G; 1011 T; 0 other;
     gcaactttga ggtgatgact acaggctccc ggttgcaata gacagtaaca aaccctgctt        60
     ctttgtattc aggagatgtt ctggactcac acaaggaaac tcgggctaga gaatgaggat       120
     aattttaaat gcaacaaccc agagtcacag atccatagtc tgcgaaagta aaacaggagc       180
     tttgagaatt taattgtaat gcagttttga cacaggtctt tcacagattg gaattctaat       240
     cattcaggga ttaccaatat tgtgctacct actgtatcaa taaacaaaaa ggaaactggt       300
     ctctatgaga atctctacct ggtgctttca gacaaaactt caccaggttt aaagagaaaa       360
     ctcctgactc tacacgtcca ttcccagggc gagctcactg tctggcatca agttccccat       420
     ggtgagtttc cctgtacaag agtccaaggg gagaggtaag tgtcctttat tttgctggat       480
     gtagtttaat attacctgag gtaaggtaag gcaaagagtg ggaggcaggg agtccagttc       540
     agggacgggg attccaggag aagtgaaggg gaaggggctg ggcgcagcct gggggtctct       600
     ccctggtttc cacagacaga tccttggcca ggactcaggc acacagtgtg acaaagatgc       660
     ttggtgtagg agaagaggga tcaggacgaa gtcccaggtc ccgggcgggg ctctcagggt       720
     ctcaggctcc aagggccgtg tctgcactgg ggaggcgccg cgttgaggat tctccactcc       780
     cctgagtttc acttcttctc ccaacctgcg tcgggtcctt cttcctgaat actcatgacg       840
     cgtccccaat tcccactccc attgggtgtc gggttctaga gaagccaatc agcgtctccg       900
     cagtcccggt tctaaagtcc ccagtcaccc acccggactc agattctccc cagacgccga       960
     gatgcgggtc atggcgcccc gaaccctcat cctgctgctc tcgggagccc tggccctgac      1020
     cgagacctgg gcctgtgagt gcggggttag gagggaaacg gcctctgcgg agaggagcga      1080
     ggggcccgcc cggcgagggc gcaggacccg gggagccgcg cagggaggag ggtcgggcgg      1140
     gtctcagcca ctcctcgtcc ccaggctccc actccatgag gtatttctcc acatccgtgt      1200
     cccggcccgg ccgcggggag ccccgcttca tcgcagtggg ctacgtggac gacacgcagt      1260
     tcgtgcggtt cgacagcgac gccgcgagtc cgagagggga gccgcgggcg ccgtgggtgg      1320
     agcaggaggg gccggagtat tgggaccggg agacacagaa gtacaagcgc caggcacaga      1380
     ctgaccgagt gagcctgcgg aacctgcgcg gctactacaa ccagagcgag gccggtgagt      1440
     gaccccggcc cggggcgcag gtcacgaccc ctccccatcc cccacggacg gcccgggtcg      1500
     ccccgagtct ccccgtctga gatccacccc gaggctgcgg aacccgccca gaccctcgac      1560
     cggagagagc cccagtcacc tttacccggt ttcattttca gtttaggcca aaatccccgc      1620
     gggttggtcg ggactggggc ggggctcggg ggacggggct gaccacgggg gcggggccag      1680
     ggtctcacac cctccagtgg atgtttggct gcgacctggg gcccgacggg cgcctcctcc      1740
     gcgggtatga ccagtccgcc tacgacggca aggattacat cgccctgaac gaggatctgc      1800
     gctcctggac cgccgcggac acggcggctc agatcaccca gcgcaagtgg gaggcggccc      1860
     gtgaggcgga gcagcggaga gcctacctgg agggcacgtg cgtggagtgg ctccgcagat      1920
     acctggagaa cgggaaggag acgctgcagc gcgcgggtac caggggcagt ggggagcctt      1980
     ccccatctcc cgtagatctc ccgggatggc ctcccacgag gaggggagga aaatgggatc      2040
     agcgctagaa tatcgccctc ccttgaatgg agaatgggat gagttttcct gagtttcctc      2100
     tgagggcccc ctctgctctc taggacaatt aagggatgaa gtccttgagg aaatggaggg      2160
     gaagacagtc cctggaatac tgatcagggg tcccctttga ccactttgac cactgcagca      2220
     gctgtggtca ggctgctgac ctttctctca ggccttgttc tctgcctcac gctcaatgtg      2280
     tttgaaggtt tgattccagc ttttctgagt ccttcggcct ccactcaggt caggaccaga      2340
     agtcgctgtt cctccctcag agactagaac tttccaatga ataggagatt atcccaggtg      2400
     cctgtgtcca ggctggcgtc tgggttctgt gcccccttcc ccaccccagg tgtcctgtcc      2460
     attctcagga tggtcacatg ggcgctgttg gagtgtcgca agagagatac aaagtgtctg      2520
     aattttctga ctcttcccgt cagaacaccc aaagacacac gtgacccacc atcccgtctc      2580
     tgaccatgag gccaccctga ggtgctgggc cctgggcttc taccctgcgg agatcacact      2640
     gacctggcag tgggatgggg aggaccaaac tcaggacacc gagcttgtgg agaccaggcc      2700
     agcaggagat ggaaccttcc agaagtgggc agctgtggtg gtgccttctg gagaagagca      2760
     gagatacacg tgccatgtgc agcacgaggg gctgccggag cccctcaccc tgagatgggg      2820
     taaggagggg gatgaggggt gatgtgtctt ctcagggaaa gcagaagtcc tggagccctt      2880
     cagccgggtc agggctgagg cttggaggtc agggcccctc accttcccct cctttcccag      2940
     agccgtcttc ccagcccacc atccccatcg tgggcatcgt tgctggcctg gctgtcctgg      3000
     ctgtcctagc tgtcctagga gctgtggtgg ctgttgtgat gtgtaggagg aagagctcag      3060
     gtagggaagg ggtgaggagt ggggtctggg ttttcttgtt ccactgggag tttcaagccc      3120
     caggtagaag tgtgccccac ctcgttactg gaagcaccat ccacacatgg gccatcccag      3180
     cctgggaccc tgtgtgccag cacttactct gttgtgaagc acatgacaat gaaggacaga      3240
     tgtatcacct tgatgattat ggtgttgggg tccttgattc cagcattcat gagtcagggg      3300
     aaggtccctg ctaaggacag accttaggag ggcagttgct tcaggaccca cagctgcttt      3360
     ccccgtgttt cctgatcctg ccctgggtct gcagtcatag ttctggaaac ttctcttggg      3420
     tccaagacta ggaggttccc ctaagatcgc atggccctgc ctcctccctg tcccctcaca      3480
     gggcattttc ttcccacagg tggaaaagga gggagctgct ctcaggctgc gtgtaagtga      3540
     tggcggtggg cgtgtggagg agctcaccca ccccataatt cctcttgtcc cacatctcct      3600
     gcgggctctg accaggtctt tttttttgtt ctaccccagc cagcaacagt gcccagggct      3660
     ctgatgagtc tctcatcgct tgtaaaggtg agattctggg gagctgaagt ggtcgggggt      3720
     ggggcagagg gaaaaggcct gggtaatggg gatcctttga ttgggacgtt tcgaatgtgt      3780
     ggtgagctgt tcagagtgtc atcacttacc atgactgacc tgaatttgtt catgactatt      3840
     gtgttctgta gcctgagaca gctgcctgtg tgggactgag atgcaggatt tcttcacacc      3900
     tctcctttgt gacttcaaga gcctctggca tctctttctg caaaggcatc tgaatgtgtc      3960
     tgcgttcctg ttagcataat gtgaggaggt ggagagacag cccacccccg tgtccaccgt      4020
     gacccctgtc cccacactga cctgtgttcc ctccccgatc atctttcctg ttccagagaa      4080
     gtgggctgga tgtctccatc tctgtctcaa cttcatggtg cgctgagctg caacttctta      4140
     cttccctaat gaagttaaga agctgaatat aaatttgttt tctcaaatat ttgctatgaa      4200
     gggttgatgg attaattaaa taagtcaatt cctggaagtt gagagagcaa ataaagacct      4260
     gagaaccttc cagaatccgc atgttcgctg tgctgagtct gttgcaggtg ggggtgggga      4320
     aggctgtgag gagacgagtg tggacggggc ctgtgcctag ttgctgttca gttcttcatg      4380
     ggctctatgt ggtcagtcct cagctgggtc accttcactg ctccattgtc cttgtccctt      4440
     cagtggaaac ttgtccagcg ggagctgtga ccacagaggc tcacacatcg cccagggcag      4500
     cccctgcaca cgggagtccc tgtgctttct gagacaa                               4537
