
ID   FJ785728; SV 1; linear; genomic DNA; STD; HUM; 4551 BP.
AC   FJ785728;
DT   29-MAR-2009 (Rel. 100, Created)
DT   29-MAR-2009 (Rel. 100, Last updated, Version 1)
DE   Homo sapiens MHC class I antigen (HLA-Cw) gene, HLA-Cw-Cw*070401 allele,
DE   promoter region and complete cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-4551
RA   Xu Y., Deng Z., Yang B.;
RT   "HLA-Cw full length cloning and sequencing: Sequence analysis from 5'
RT   upstream region through 3' downstream region";
RL   Unpublished.
RN   [2]
RP   1-4551
RA   Xu Y., Deng Z., Yang B.;
RT   ;
RL   Submitted (23-FEB-2009) to the INSDC.
RL   Immunogenetic Laboratory, Shenzhen Blood Center, 2# Meigang South Street,
RL   Nigang West Road, Shenzhen, Guangdong 518035, China
DR   MD5; 8dab4cf864cf6b7bf577037fcedfa52c.
FH   Key             Location/Qualifiers
FT   source          1..4551
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: CwF, fwd_seq:
FT                   cgcaactttgaggtgatgact, rev_name: CwR, rev_seq:
FT                   ttgtctcagaaagcacaggga"
FT                   /db_xref="taxon:9606"
FT   gene            1..4551
FT                   /gene="HLA-Cw"
FT                   /allele="Cw*070401"
FT   misc_feature    1..966
FT                   /gene="HLA-Cw"
FT                   /allele="Cw*070401"
FT                   /note="contains promoter and 5' UTR"
FT   mRNA            join(<967..1039,1170..1439,1690..1965,2553..2828,
FT                   2953..3072,3513..3545,3653..3700,3865..4551)
FT                   /gene="HLA-Cw"
FT                   /allele="Cw*070401"
FT                   /product="MHC class I antigen"
FT   CDS             join(967..1039,1170..1439,1690..1965,2553..2828,2953..3072,
FT                   3513..3545,3653..3700,3865..3869)
FT                   /codon_start=1
FT                   /gene="HLA-Cw"
FT                   /allele="Cw*070401"
FT                   /product="MHC class I antigen"
FT                   /note="glycoprotein"
FT                   /db_xref="GOA:Q7YQB2"
FT                   /db_xref="IMGT/HLA:C*07:04:01"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR010579"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:Q7YQB2"
FT                   /protein_id="ACN97194.1"
FT   3'UTR           3870..4551
FT                   /gene="HLA-Cw"
FT                   /allele="Cw*070401"
SQ   Sequence 4551 BP; 930 A; 1254 C; 1353 G; 1014 T; 0 other;
     gcaactttga ggtgatgact acaggctccc ggttgcaata gacagtaaca aaccctgctt        60
     ctttgtattc aggagatgtt ctggactcac acagggaaac tctggctaga gaatgaggat       120
     aactttaaat gcaacaaccc agagtcacag atccatagtc tgcgaaagta aaacaggagc       180
     tttgagaatt taattgtaat acagttttga cacaggtctt tcacagattg gaattctaat       240
     cattcaggga ttaccaatat tgtgctacct actgtatcaa taaacaaaaa ggaaactggt       300
     ctctatgaga atctctacct ggtgctttca gacaaaactt caccaggttt aaagagaaaa       360
     ctcctgactc tacacgtcca ttcccagggc gagctcactg tctggcatca agttccccat       420
     ggtgagtttc cctgtacaag agtccaaggg gagaggtaag tgtcctttat tttgctggat       480
     gtagtttaat attacctgag gtgaggtaag gtaaggcaaa gggtgggagg cagggagtcc       540
     agttcaggga cggggattcc aggaggagaa gtgaagggga aggggctggg cgcagccttg       600
     gggtctctcc ctggtttcca cagacagatc cttgtccagg actcaggcac acagtgtgac       660
     aaagatgctt ggtgtaggag aagagggatc aggacgaagt cccaggtccc gggcggggct       720
     ctcagggtct caggctccaa gggccgtgtc tgcactgggg aggcgccgcg ttgaggattc       780
     tccactcccc tgagtttcac ttctcccaac ctgcgtcggg tccttcttcc tgaatactca       840
     tgacgcgtcc ccaattccca ctcccattgg gtgtcgggtt ctagagaagc caatcagcgt       900
     ctccgcagtc ccggttctaa agtccccagt cacccacccg gactcacatt ctccccagag       960
     gccgagatgc gggtcatggc gccccgagcc ctcctcctgc tgctctcggg aggcctggcc      1020
     ctgaccgaga cctgggcctg tgagtgcggg gttgggaggg aagcggcctc tgcggagagg      1080
     agcgaggggc cctcccggcg agggcgcagg acccggggag ccgcgcaggg aggtgggtcg      1140
     ggcgggtctc agcccctcct cgcccccagg ctcccactcc atgaggtatt tcgacaccgc      1200
     cgtgtcccgg cccggccgcg gagagccccg cttcatctca gtgggctacg tggacgacac      1260
     gcagttcgtg cggttcgaca gcgacgccgc gagtccgaga ggggagcccc gggcgccgtg      1320
     ggtggagcag gaggggccgg agtattggga ccgggagaca cagaagtaca agcgccaggc      1380
     acaggctgac cgagtgagcc tgcggaacct gcgcggctac tacaaccaga gcgaggacgg      1440
     tgagtgaccc cggcccgggg cgcaggtcac gacccctccc catcccccac ggacggcccg      1500
     ggtcgccccg agtctccccg tctgagatcc accccaaggt ggatctgcgg aacccgccca      1560
     gaccctcgac cggagagagc cccagtcgcc tttacccggt ttcattttcg gtttaggcca      1620
     aaatccccgc gggttggtcg gggcggggcg gggctcgggg gactgggctg accgcggggg      1680
     cggggccagg gtctcacacc ttccagagga tgtatggctg cgacctgggg cccgacgggc      1740
     gcctcctccg cgggtatgac cagttcgcct acgacggcaa ggattacatc gccctgaacg      1800
     aggacctgcg ctcctggacc gccgcggaca ccgcggctca gatcacccag cgcaagttgg      1860
     aggcggcccg tgcggcggag caggacagag cctacctgga gggcacgtgc gtggagtggc      1920
     tccgcagata cctggagaac gggaagaaga cgctgcagcg cgcgggtacc aggggcagtg      1980
     gggagccttc cccatctcct atagatctcc cgggatggcc tcccacgagg aggggaggaa      2040
     aatgggatca gcactggaat atcgccctcc cttgaatgga gaatggcatg agttttcctg      2100
     agtttcctct gagggccccc tctgctctct aggacaatta agggatgaag tctctgagga      2160
     aatggagggg aagacagtcc ctggaatact gatcaggggt ctcctttgac cactttgacc      2220
     actgcagcag ctgtggtcag gctgctgacc tttctctcag gccttgttct ctgcctcaca      2280
     ctcaatgtgt ctgaaggttt gattccagct tttctgagtc ctgcagcctc cactcaggtc      2340
     aggaccagaa gtcgctgttc ctccctcaga gactagaact ttccaatgaa taggagatta      2400
     tcccaggtgc ctgtgtccag gctggcgtct gggttctgtg ccgccttccc caccccaggt      2460
     gtcctgtcca ttctcaggat ggtcacatgg gcgctgctgg agtgtcccaa gagagatgca      2520
     aagtgtctga attttctgac tcttcccgtc agaaccccca aagacacacg tgacccacca      2580
     ccccctctct gaccatgagg ccaccctgag gtgctgggcc ctgggcttct accctgcgga      2640
     gatcacactg acctggcagc gggatgggga ggaccagacc caggacaccg agcttgtgga      2700
     gaccaggcca gcaggagatg gaaccttcca gaagtgggca gctgtggtgg tgccttctgg      2760
     acaagagcag agatacacgt gccatatgca gcacgagggg ctgcaagagc ccctcaccct      2820
     gagctggggt aaggagggga atggggggtc acatctctta tcagagaaag cagaagtcct      2880
     tctggagccc ttcagccggg tcagggctga ggcttggggg tcagggcccc tcaccttctc      2940
     ctcctttccc agagccatct tcccagccca ccatccccat catgggcatc gttgctggcc      3000
     tggctgtcct ggttgtccta gctgtccttg gagctgtggt caccgctatg atgtgtagga      3060
     ggaagagctc aggtagggaa ggggtgaaga gcggggtctg ggttttcttg tcccactggg      3120
     agtttcaagc cccaggtaga agtgtgcccc gccttgttac tggaagcacc atccacacat      3180
     gggccatccc agcctgggac cctgtgtgcc agcacttact cttttgtgaa gcacatgtga      3240
     caatgaagga cggatgtatc accttgatga ttatggtgtt ggggtcctga ttccagcatt      3300
     catgagtcag gggaaggtcc ctgctaagga cagaccttag gagggcagtt ggtccagaac      3360
     ccacagctgc tttccccatg tttcctgatc ctgccctggg tctgcagtcg tagttctgga      3420
     aacttctctt gggtccaaga ctaggaggtt cccctaagat cacatggccc tgcctcctcc      3480
     cagtcccctc atagggcatt ttcttcccac aggtggaaaa ggagggagct gctctcaggc      3540
     tgcgtgtaag tgatggcggc gggcgtgtgg aggagctcac ctactccata attcctcttg      3600
     tcccacatct cctgcgggct ctgaccaggt cttttttttt gttctacccc aggcagcaac      3660
     agtgcccagg gctctgatga gtctctcatc acttgtaaag gtgagattct ggggagctga      3720
     agtggtcggg ggtggggcag agggaaaagg cctgggtaat ggggattctt tgattgggac      3780
     gtttcgagtg tgtggtgggc cgttcagagt gtcatcactt accatgactg acctgaattt      3840
     gttcatgact attgtgttct gtagcctgag acagctgcct gtgtgggact gagatgcagg      3900
     atttcttcac acctctcctt tgtgacttca agagcctctg gcatctcttt ctgcaaaggc      3960
     atctgaatgt gtctgcgttc ctgttagcat aatgtgagga ggtggagaga cagcccaccc      4020
     ccgtgtccac cgtgacccct gtccccacac tgacctgtgt tccctccccg atcatctttc      4080
     ctgttccaga gaggtggggc tggatgtctc catctctgtc tcaaattcat ggtgcactga      4140
     gctgcaactt cttacttccc taatgaagtt aagaacctga atataaattt gtgttctcaa      4200
     atatttgcta tgaagcgttg atggattaat taaataagtc aattcctaga agttgagaga      4260
     gcaaataaag acctgagaac cttccagaat ttgcatgttc gctgtgctga gtctgttgca      4320
     ggtgggggtg gggaaggctg tgaggagccg agtgtggacg gggcctgtgc ctagttgctg      4380
     ttcagttctt catgggcttt atgtggtcag tcctcagctg ggtcaccttc actgctccat      4440
     tgtccttgtc ccttcagtgg aaacttgtcc agcggaagct gtgaccacag aggctcaccc      4500
     atcgcccagg gcagcccctg cacacgggag tccctgtgct ttctgagaca a               4551