
EBI Dbfetch

ID   FJ449755; SV 1; linear; genomic DNA; STD; HUM; 935 BP.
AC   FJ449755;
DT   31-AUG-2009 (Rel. 102, Created)
DT   31-AUG-2009 (Rel. 102, Last updated, Version 1)
DE   Homo sapiens MHC class I antigen (HLA-G) gene, exons 1 through 3 and
DE   partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-935
RX   DOI; 10.1111/j.1399-0039.2009.01309.x.
RX   PUBMED; 19624483.
RA   Roman A., Cervera I., Herraiz M.A., Vidart J., Martinez-Laso J.;
RT   "A new allele, HLA-G*01010106, with changes in intron 2";
RL   Tissue Antigens 74(3):270-271(2009).
RN   [2]
RP   1-935
RA   Martinez-Laso J., Roman A., Rodriguez M., Cervera I.;
RT   ;
RL   Submitted (11-NOV-2008) to the INSDC.
RL   Inmunoterapia Celular, ISCIII, Carretera De Majadahonada Km.2,
RL   Majadahonada, Madrid 28220, Spain
DR   MD5; b6f0aa622375cc31c051d6414552280f.
DR   Ensembl-Gn; ENSG00000204632; homo_sapiens.
DR   Ensembl-Gn; ENSG00000206506; homo_sapiens.
DR   Ensembl-Gn; ENSG00000230413; homo_sapiens.
DR   Ensembl-Gn; ENSG00000233095; homo_sapiens.
DR   Ensembl-Gn; ENSG00000235346; homo_sapiens.
DR   Ensembl-Gn; ENSG00000235680; homo_sapiens.
DR   Ensembl-Gn; ENSG00000237216; homo_sapiens.
DR   Ensembl-Gn; ENSG00000264751; homo_sapiens.
DR   Ensembl-Tr; ENST00000360323; homo_sapiens.
DR   Ensembl-Tr; ENST00000376828; homo_sapiens.
DR   Ensembl-Tr; ENST00000383621; homo_sapiens.
DR   Ensembl-Tr; ENST00000400665; homo_sapiens.
DR   Ensembl-Tr; ENST00000400682; homo_sapiens.
DR   Ensembl-Tr; ENST00000420559; homo_sapiens.
DR   Ensembl-Tr; ENST00000422371; homo_sapiens.
DR   Ensembl-Tr; ENST00000423011; homo_sapiens.
DR   Ensembl-Tr; ENST00000423373; homo_sapiens.
DR   Ensembl-Tr; ENST00000428701; homo_sapiens.
DR   Ensembl-Tr; ENST00000428952; homo_sapiens.
DR   Ensembl-Tr; ENST00000434881; homo_sapiens.
DR   Ensembl-Tr; ENST00000444098; homo_sapiens.
DR   Ensembl-Tr; ENST00000449127; homo_sapiens.
DR   Ensembl-Tr; ENST00000450984; homo_sapiens.
DR   Ensembl-Tr; ENST00000546545; homo_sapiens.
DR   Ensembl-Tr; ENST00000546634; homo_sapiens.
DR   Ensembl-Tr; ENST00000547241; homo_sapiens.
DR   Ensembl-Tr; ENST00000547931; homo_sapiens.
DR   Ensembl-Tr; ENST00000550897; homo_sapiens.
DR   Ensembl-Tr; ENST00000553052; homo_sapiens.
DR   Ensembl-Tr; ENST00000582523; homo_sapiens.
DR   Ensembl-Tr; ENST00000583373; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..935
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: ccctgaccctgaccgagacctgg, rev_seq:
FT                   ggtacccgcgcgctgcagca"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>935
FT                   /gene="HLA-G"
FT   mRNA            join(<1..27,157..426,654..>929)
FT                   /gene="HLA-G"
FT                   /product="MHC class I antigen"
FT   CDS             join(<1..27,157..426,654..>929)
FT                   /codon_start=3
FT                   /gene="HLA-G"
FT                   /product="MHC class I antigen"
FT                   /db_xref="GOA:C7SJ32"
FT                   /db_xref="IMGT/HLA:G*01:01:01:06"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:C7SJ32"
FT                   /protein_id="ACO25292.1"
FT   exon            <1..27
FT                   /gene="HLA-G"
FT                   /number=1
FT   exon            157..426
FT                   /gene="HLA-G"
FT                   /number=2
FT   exon            654..929
FT                   /gene="HLA-G"
FT                   /number=3
SQ   Sequence 935 BP; 174 A; 304 C; 338 G; 119 T; 0 other;
     ccctgaccct gaccgagacc tgggcgggtg agtgcggggt caggagggaa acagcccctg        60
     cgcggaggag ggaggggccg gcccggcggg ggcgcaggac tcggcagccg cgccgggagg       120
     agggtcgggc gggtctcaac ccctcctcgc ccccaggctc ccactccatg aggtatttca       180
     gcgccgccgt gtcccggccc ggccgcgggg agccccgctt catcgccatg ggctacgtgg       240
     acgacacgca gttcgtgcgg ttcgacagcg actcggcgtg tccgaggatg gagccgcggg       300
     cgccgtgggt ggagcaggag gggccggagt attgggaaga ggagacacgg aacaccaagg       360
     cccacgcaca gactgacaga atgaacctgc agaccctgcg cggctactac aaccagagcg       420
     aggccagtga gtaaccccgg cccagggcgc agatcacgac cccccacctc catgccccac       480
     ggacgccccg ggtactcccg agtctccggg tctgggatcc accccgaggc cgcgggaccc       540
     gcccagaccc tctacctggg agaaccccaa ggcgccttta ccaaaatccc cgcgggtggg       600
     tccgggcgag ggcgaggctc ggtgggcggg gctgaccgag ggggtggggc caggttctca       660
     caccctccag tggatgattg gctgcgacct ggggtccgac ggacgcctcc tccgcgggta       720
     tgaacagtat gcctacgatg gcaaggatta cctcgccctg aacgaggacc tgcgctcctg       780
     gaccgcagcg gacactgcgg ctcagatctc caagcgcaag tgtgaggcgg ccaatgtggc       840
     tgaacaaagg agagcctacc tggagggcac gtgcgtggag tggctccaca gatacctgga       900
     gaacgggaag gagatgctgc agcgcgcggg tacca                                  935
