
ID   EU998646; SV 1; linear; genomic DNA; STD; HUM; 787 BP.
AC   EU998646;
DT   10-SEP-2008 (Rel. 97, Created)
DT   11-SEP-2008 (Rel. 97, Last updated, Version 2)
DE   Homo sapiens MHC class I antigen (HLA-A) gene, HLA-A*025602 allele, partial
DE   cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-787
RA   Lee T.-D., Chien W.-C.;
RT   "A novel HLA-A2 variant, identified by sequence-based typing";
RL   Unpublished.
RN   [2]
RP   1-787
RA   Lee T.-D., Chien W.-C.;
RT   ;
RL   Submitted (04-AUG-2008) to the INSDC.
RL   Research and Development, Healthbanks Biotech Co.,Ltd, Building B, Room405,
RL   No.18 Sihyuan St, Jungieng District, Taipei 10091, Taiwan,R.O.C.
DR   MD5; 803217a4e6769c34eca7b8fae848cde0.
FH   Key             Location/Qualifiers
FT   source          1..787
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="cord blood"
FT                   /PCR_primers="fwd_name: I1-226, fwd_seq:
FT                   ctctgtggggagaagcaac, rev_name: I3-249, rev_seq:
FT                   cagagtcactctctggtacag"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>787
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*025602"
FT   CDS             join(<1..270,512..>787)
FT                   /codon_start=3
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*025602"
FT                   /product="MHC class I antigen"
FT                   /db_xref="IMGT/HLA:A*02:56:02"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="UniProtKB/TrEMBL:B5TM11"
FT                   /protein_id="ACH81021.1"
FT                   VEWLRRYLENGKETLQRT"
FT   gap             271..511
FT                   /estimated_length=241
SQ   Sequence 787 BP; 111 A; 161 C; 194 G; 80 T; 241 other;
     gctctcactc catgaggtat ttcttcacat ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc agtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagccagag gatggagccg cgggcgccgt ggatagagca ggaggggccg gagtattggg       180
     accaggagac acggaatgtg aaggcccagt cacagactca ccgagtggac ctggggaccc       240
     tgcgcggcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       420
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       480
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ngttctcaca ccgtccagag gatgtatggc       540
     tgcgacgtgg ggtcggactg gcgcttcctc cgcgggtacc accagtacgc ctacgacggc       600
     aaggattaca tcgccctgaa agaggacctg cgctcttgga ccgcggcgga catggcagct       660
     cagaccacca agcacaagtg ggaggcggcc catgtggcgg agcagttgag agcctacctg       720
     gagggcacgt gcgtggagtg gctccgcaga tacctggaga acgggaagga gacgctgcag       780
     cgcacgg                                                                 787