
EBI Dbfetch

ID   EU589203; SV 1; linear; genomic DNA; STD; HUM; 792 BP.
AC   EU589203;
DT   26-MAR-2009 (Rel. 100, Created)
DT   26-MAR-2009 (Rel. 100, Last updated, Version 1)
DE   Homo sapiens MHC class I antigen (HLA-B) gene, HLA-B*35new allele, exons 2,
DE   3 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-792
RX   DOI; 10.1111/j.1399-0039.2008.01195.x.
RX   PUBMED; 19144089.
RA   Phipps M., Jianm T.;
RT   "A new HLA-B*35 allele, B*3589, detected in a Malaysian individual";
RL   Tissue Antigens 73(3):279-280(2009).
RN   [2]
RP   1-792
RA   Phipps M., Tait B., Diviney M., Kanaan C., Fry J.;
RT   "New HLA-B*35 allele found in Jehai tribe of Malaysia";
RL   Unpublished.
RN   [3]
RP   1-792
RA   Phipps M., Tait B., Diviney M., Kanaan C., Fry J.;
RT   ;
RL   Submitted (24-MAR-2008) to the INSDC.
RL   Department of Molecular Medicine, University of Malaya, Kuala Lumpur 50603,
RL   Malaysia
DR   MD5; 0e03ce33e2af07ac488f60a0fa96c83d.
FH   Key             Location/Qualifiers
FT   source          1..792
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq:
FT                   tgtaaaacgacggccagtggcgggggcgcaggacctg, rev_name: B2,
FT                   rev_seq: caggaaacagctatgaccccatcccsggcgayctat"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>792
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*35new"
FT   mRNA            join(<1..270,517..>792)
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*35new"
FT                   /product="MHC class I antigen"
FT   CDS             join(<1..270,517..>792)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*35new"
FT                   /product="MHC class I antigen"
FT                   /db_xref="GOA:C0IY87"
FT                   /db_xref="IMGT/HLA:B*35:89"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:C0IY87"
FT                   /protein_id="ACF04948.1"
FT                   VEWLCRYLENGKETLQRA"
FT   exon            1..270
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*35new"
FT                   /number=2
FT   exon            517..792
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*35new"
FT                   /number=3
SQ   Sequence 792 BP; 141 A; 267 C; 280 G; 104 T; 0 other;
     gctcccactc catgaggtat ttctacaccg ccatgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc agtgggctac gtggacgaca cccagttcgt gaggttcgac agcgacgccg       120
     cgagtccgag gacggagccc cgggcgccat ggatagagca ggaggggccg gagtattggg       180
     accggaacac acagatcttc aagaccaaca cacagactta ccgagagagc ctgcggaacc       240
     tgcgcggcta ctacaaccag agcgaggccg gtgagtgacc ccggcccggg gcgcaggtca       300
     cgactcccca tcccccacgt acggcccggg tcgccccgag tctccgggtc cgagatccgc       360
     ctccctgagg ccgcgggacc cgcccagacc ctcgaccggc gagagcccca ggcgcgttta       420
     cccggtttca ttttcagttg aggccaaaat ccccgcgggt tggtcggggc ggggcggggc       480
     tcggggggac ggggctgacc gcgggggcgg ggccagggtc tcacaccctc cagagcatgt       540
     acggctgcga cctggggccc gacgggcgcc tcctccgcgg gcatgaccag tccgcctacg       600
     acggcaagga ttacatcgcc ctgaacgagg acctgagctc ctggaccgcg gcggacaccg       660
     cggctcagat cacccagcgc aagtgggagg cggcccgtgt ggcggagcag ctgagagcct       720
     acctggaggg cctgtgcgtg gagtggctct gcagatacct ggagaacggg aaggagacgc       780
     tgcagcgcgc gg                                                           792
