
ID   EU480687; SV 1; linear; genomic DNA; STD; HUM; 646 BP.
AC   EU480687;
DT   16-MAR-2008 (Rel. 95, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens MHC class I antigen (HLA-A) gene, HLA-A*33 variant allele,
DE   exons 2, 3 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-646
RA   Badger T.L., Han M., Stastny P.;
RT   "Identification of a novel HLA-Cw allele, a HLA-Cw*04 variant";
RL   Unpublished.
RN   [2]
RP   1-646
RA   Badger T.L., Han M., Stastny P.;
RT   ;
RL   Submitted (12-FEB-2008) to the INSDC.
RL   Transplant Immunology, UT Southwestern Medical Center, 5323 Harry Hines
RL   Blvd, Dallas, TX 75390, USA
DR   MD5; 0884e3488903ee0db60b5a0e48a57b9b.
FH   Key             Location/Qualifiers
FT   source          1..646
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: gtgagtgcggggtcgtgg, rev_seq:
FT                   cagagtcactctctggtacag"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>646
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*33 variant"
FT   mRNA            join(<1..270,371..>646)
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*33 variant"
FT                   /product="MHC class I antigen"
FT   CDS             join(<1..270,371..>646)
FT                   /codon_start=3
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*33 variant"
FT                   /product="MHC class I antigen"
FT                   /db_xref="IMGT/HLA:A*33:16"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:B1PMU7"
FT                   /protein_id="ACA79968.1"
FT                   VEWLRRHLENGKETLQRT"
FT   exon            1..270
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*33 variant"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*33 variant"
FT                   /number=3
SQ   Sequence 646 BP; 106 A; 165 C; 197 G; 78 T; 100 other;
     gctcccactc catgaggtat ttcaccacat ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc cgtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagccagag gatggagccg cgggcgccgt ggatagagca ggaggggccg gagtattggg       180
     accggaacac acggaatgtg aaggcccact cacagattga ccgagtggac ctggggaccc       240
     tgcgcggcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn gttctcacac catccagatg atgtatggct gcgacgtggg gtcggacggg       420
     cgcttcctcc gcgggtacca gcaggacgcc tacgacggca aggattacat cgccttgaac       480
     gaggacctgc gctcttggac cgcggcggcc atggcggctc agatcaccca gcgcaagtgg       540
     gaggcggccc gtgtggcgga gcagttgaga gcctacctgg agggcacgtg cgtggagtgg       600
     ctccgcagac acctggagaa cgggaaggag acgctgcagc gcacgg                      646