spacer

EBI Dbfetch

ID   EU078908; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
XX
AC   EU078908;
XX
DT   28-AUG-2007 (Rel. 93, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
XX
DE   Homo sapiens nonfunctional MHC class I antigen (HLA-DRB1) gene,
DE   HLA-DRB1*16null allele, exon 2.
XX
KW   .
XX
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
XX
RN   [1]
RP   1-270
RA   Zhao W., Guerrero E., McKissick E., Kerman R., Cano P.,
RA   Fernandez-Vina M.A.;
RT   "DRB1*16 null allele with a premature termination codon";
RL   Unpublished.
XX
RN   [2]
RP   1-270
RA   Zhao W., Guerrero E., Cano P., Fernandez-Vina M.A.;
RT   ;
RL   Submitted (02-AUG-2007) to the INSDC.
RL   Laboratory Medicine, MD Anderson Cancer Center, 8515 Fannin Street,
RL   Houston, TX 77054, USA
XX
DR   MD5; aebd7c394380209b1fc85d2b103810a4.
DR   IMGT/HLA; DRB1*16:13N; HLA03062.
XX
FH   Key             Location/Qualifiers
FH
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /cell_type="peripheral blood nucleated cells"
FT                   /PCR_primers="fwd_seq: ggtgggtgctgttgaaggt, rev_seq:
FT                   acacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*16null"
FT   mRNA            <1..>270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*16null"
FT                   /product="MHC class I antigen"
FT   exon            1..270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*16null"
FT                   /number=2
FT   misc_feature    1..270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*16null"
FT                   /note="nonfunctional MHC class I antigen due to mutation in
FT                   exon 2 that results in a premature termination codon"
XX
SQ   Sequence 270 BP; 57 A; 66 C; 98 G; 49 T; 0 other;
     cacgtttcct gtggcagcct aagagggagt gtcatttctt caatgggacg gagcgggtgc        60
     ggttcctgga cagatacttc tataaccagg aggagtccgt gcgcttcgac agcgacgtgg       120
     gggagtaccg ggcggtgacg tagctggggc ggcctgacgc tgagtactgg aacagccaga       180
     aggacttcct ggaagacagg cgcgccgcgg tggacaccta ctgcagacac aactacgggg       240
     ttggtgagag cttcacagtg cagcggcgag                                        270
//


spacer
spacer