
ID   EF493833; SV 1; linear; genomic DNA; STD; HUM; 427 BP.
AC   EF493833;
DT   24-APR-2007 (Rel. 91, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens MHC class II antigen (HLA-DRB1) gene, HLA-DRB1*1379 allele,
DE   exon 2 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-427
RA   Duignan P., Varney M., Holdsworth R.;
RT   "New DRB1*13 allele found in cord blood";
RL   Unpublished.
RN   [2]
RP   1-427
RA   Duignan P., Varney M., Holdsworth R.;
RT   ;
RL   Submitted (14-MAR-2007) to the INSDC.
RL   Victorian Transplantation & Immunogenetics Service, Australian Red Cross
RL   Blood Service (ARCBS), Cnr Kavanagh & Balston Streets, South Melbourne,
RL   Melbourne, VIC 3205
DR   MD5; 5e6858fa699fbed96168a860e2423491.
FH   Key             Location/Qualifiers
FT   source          1..427
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="cord blood"
FT                   /PCR_primers="fwd_name: I1-RB9mf, fwd_seq:
FT                   tgtaaaacgacggccagtgtgggcgttgcggcggc, rev_name: I2-RB28mr,
FT                   rev_seq: caggaaacagctatgaccacacacacactcagattccca"
FT                   /PCR_primers="fwd_name: I1-RB10mf, fwd_seq:
FT                   tgtaaaacgacggccagttggtgggcgttggggcg, rev_name: I2-RB28mr,
FT                   rev_seq: caggaaacagctatgaccacacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>427
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1379"
FT   mRNA            <119..>388
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1379"
FT                   /product="MHC class II antigen"
FT   CDS             <119..>388
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1379"
FT                   /product="MHC class II antigen"
FT                   /db_xref="GOA:Q5Y7A7"
FT                   /db_xref="HGNC:HGNC:4948"
FT                   /db_xref="IMGT/HLA:DRB1*13:79"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q5Y7A7"
FT                   /protein_id="ABP68561.1"
FT   exon            119..388
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1379"
FT                   /number=2
SQ   Sequence 427 BP; 75 A; 117 C; 157 G; 78 T; 0 other;
     gcggccggtt aaggttccca gtgcccgcac ccggcccagg gagccccgga tggcggcgtc        60
     actgtcagtg tcttctcagg aggccgcctg tgtgactgga tcgttcgtgt ccccacagca       120
     cgtttcttgg agtactctac gtctgagtgt catttcttca atgggacgga gcgggtgcgg       180
     ttcctggaca gatacttcca taaccaggag gagaacgtgc gcttcgacag cgacgtgggg       240
     gagttccggg cggtgacgga gctggggcgg cctgatgccg agtcctggaa cagccagaag       300
     gacatcctgg aagacgagcg ggccgcggtg gacacctact gcagacacaa ctacggggtt       360
     gtggagagct tcacagtgca gcggcgaggt gagcgcggcg cggggcgggg cctgagtccc       420
     tgtgagc                                                                 427