
ID   EF493832; SV 1; linear; genomic DNA; STD; HUM; 427 BP.
AC   EF493832;
DT   24-APR-2007 (Rel. 91, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens MHC class II antigen (HLA-DRB1) gene, HLA-DRB1*1378 allele,
DE   exon 2 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-427
RA   Moore J., Bowman S., Varney M., Tait B.;
RT   "New HLA DR13 sequence found in bone marrow donor";
RL   Unpublished.
RN   [2]
RP   1-427
RA   Moore J., Bowman S., Varney M., Tait B.;
RT   ;
RL   Submitted (14-MAR-2007) to the INSDC.
RL   Victorian Transplantation & Immunogenetics Service, Australian Red Cross
RL   Blood Service (ARCBS), Cnr Kavanagh & Balston Streets, South Melbourne,
RL   Melbourne, VIC 3205, Australia
DR   MD5; 72e11be5c362ff7e882078d5a46ebc4c.
FH   Key             Location/Qualifiers
FT   source          1..427
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: I1-RB9mf, fwd_seq:
FT                   tgtaaaacgacggccagttggtgggcgttggggcg, rev_name: I2-RB28mr,
FT                   rev_seq: caggaaacagctatgaccacacacacactcagattccca"
FT                   /PCR_primers="fwd_name: I1-RB10mf, fwd_seq:
FT                   tgtaaaacgacggccagtgtgggcgttgcggcggc, rev_name: I2-RB28mr,
FT                   rev_seq: caggaaacagctatgaccacacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>427
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1378"
FT   mRNA            <119..>388
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1378"
FT                   /product="MHC class II antigen"
FT   CDS             <119..>388
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1378"
FT                   /product="MHC class II antigen"
FT                   /db_xref="GOA:Q5Y7A7"
FT                   /db_xref="HGNC:HGNC:4948"
FT                   /db_xref="IMGT/HLA:DRB1*13:78"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q5Y7A7"
FT                   /protein_id="ABP68560.1"
FT   exon            119..388
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1378"
FT                   /number=2
SQ   Sequence 427 BP; 74 A; 118 C; 157 G; 78 T; 0 other;
     gcggccggtt aaggttccca gtgcccgcac ccggcccagg gagccccgga tggcggcgtc        60
     actgtcagtg tcttctcagg aggccgcctg tgtgactgga tcgttcgtgt ccccacagca       120
     cgtttcttgg agtactctac gtctgagtgt catttcttca atgggacgga gcgggtgcgg       180
     ttcctggaca gatacttcca taaccaggag gagaacgtgc gcttcgacag cgacgtgggg       240
     gagttccggg cggtgacgga gctggggcgg cctgatgccg agtcctggaa cagccagaag       300
     gacctcctgg aagacgagcg ggccgcggtg gacacctact gcagacacaa ctacggggtt       360
     gtggagagct tcacagtgca gcggcgaggt gagcgcggcg cggggcgggg cctgagtccc       420
     tgtgagc                                                                 427