
EBI Dbfetch

ID   EF471909; SV 1; linear; genomic DNA; STD; HUM; 719 BP.
AC   EF471909;
DT   06-APR-2007 (Rel. 91, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens MHC class II antigen (HLA-DRB1) gene, HLA-DRB1*03new allele,
DE   exon 2 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-719
RA   Louey A., Bowman S., Varney M., Tait B.;
RT   "New DRB1*03 allele in diabetic family";
RL   Unpublished.
RN   [2]
RP   1-719
RA   Louey A., Bowman S., Varney M., Tait B.;
RT   ;
RL   Submitted (06-MAR-2007) to the INSDC.
RL   Victorian Transplantation & Immunogenetics Service, Australian Red Cross
RL   Blood Service, Cnr Kavanagh & Balston Streets, South Melbourne, Melbourne,
RL   VIC 3205, Australia
DR   MD5; 8dfdcb2b19c50975cfccfe064e839f70.
FH   Key             Location/Qualifiers
FT   source          1..719
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: agcactaaggaagggttcag, rev_seq:
FT                   acacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>719
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*03new"
FT   mRNA            <411..>680
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*03new"
FT                   /product="MHC class II antigen"
FT   CDS             <411..>680
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*03new"
FT                   /product="MHC class II antigen"
FT                   /db_xref="GOA:A4URM3"
FT                   /db_xref="IMGT/HLA:DRB1*03:33"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:A4URM3"
FT                   /protein_id="ABO69630.1"
FT   exon            411..680
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*03new"
FT                   /number=2
SQ   Sequence 719 BP; 128 A; 186 C; 276 G; 129 T; 0 other;
     aggatgaacg cggtgggtgc tgtttaagga accggtaaac atgtgggatg agagaaggag        60
     cagagtgtct ttggggtgga ggctcccagg aggaggcggc gcgggctgcg gtgctgggcg       120
     gatcctcctc cagctcctgc ttggaggtct ccagaacagg ctggaggtag ggaggggggt       180
     cccaaaagcc tggggatcag acgtggtttt cccgcctggt cccccaggcc ccctttcgcc       240
     tcaggaagac agaggaggag cccctgggct gctggtggtg ggcgttgcgg cgggggccgg       300
     ttaaggttcc cagtgcccgc accccaccca gggagccccg gatggcggcg tcactgtcag       360
     tgtcttctca ggaggccgcc tgtgtgactg gatcgttcgt gtccccacag cacgtttctt       420
     ggagtactct acgtctgagt gtcatttctt caatgggacg gagcgggtgc ggtacctgga       480
     cagatacttc cataaccagg aggagaacgc gcgcttcgac agcgacgtgg gggagttccg       540
     ggcggtgacg gagctggggc ggcctgatgc cgagtactgg aacagccaga aggacctcct       600
     ggagcagaag cggggccggg tggacaacta ctgcagacac aactacgggg ttgtggagag       660
     cttcacagtg cagcggcgag gtgagcgcgg cgcggggcgg ggcctgagtc cctgtgagc        719
