
ID   EF468681; SV 1; linear; genomic DNA; STD; HUM; 787 BP.
AC   EF468681;
DT   08-MAY-2007 (Rel. 91, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 3)
DE   Homo sapiens MHC class I antigen (HLA-A) gene, HLA-A*02new allele, exons 2,
DE   3 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-787
RX   DOI; 10.1111/j.1399-0039.2008.01028.x.
RX   PUBMED; 18331523.
RA   Jiang W., Zhang J.Q., Pan N., Xu J.H., Xie W.;
RT   "Identification of a novel HLA-A allele, HLA-A*9216";
RL   Tissue Antigens 71(5):479-480(2008).
RN   [2]
RP   1-787
RA   Jiang W., Zhang J., Pan N., Wei J., Xu J., Xie W.;
RT   ;
RL   Submitted (04-MAR-2007) to the INSDC.
RL   Department of Genetics and Development Biology, Southeast University
RL   Medical School, 87 Ding Jia Qiao Road, Nanjing, Jiangsu 210009, P.R.China
DR   MD5; fe690f6529349103655df38b50117c03.
DR   EuropePMC; PMC3187788; 21998681.
DR   EuropePMC; PMC3842051; 24312130.
FH   Key             Location/Qualifiers
FT   source          1..787
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p23.1"
FT                   /isolate="S100"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: A1, fwd_seq:
FT                   gaaacsgcctctgyggggagaagcaa, rev_name: A3, rev_seq:
FT                   tgttggtcccaattgtctcccctc"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>787
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT   mRNA            join(<1..270,512..>787)
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT                   /product="MHC class I antigen"
FT   CDS             join(<1..270,512..>787)
FT                   /codon_start=3
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT                   /product="MHC class I antigen"
FT                   /db_xref="GOA:A5HBZ4"
FT                   /db_xref="IMGT/HLA:A*02:116"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:A5HBZ4"
FT                   /protein_id="ABQ10632.1"
FT                   VEWLRRYLENGKETLQRT"
FT   exon            1..270
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT                   /number=2
FT   exon            512..787
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*02new"
FT                   /number=3
SQ   Sequence 787 BP; 145 A; 250 C; 279 G; 113 T; 0 other;
     gctctcactc catgaggtat ttcttcacat ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc agtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagccagag gatggagccg cgggcgccgt ggatagagca ggagggtccg gagtattggg       180
     acggggagac acggaaagtg aaggcccact cacagactca ccgactggac ctggggaccc       240
     tgcgcggcta ctacaaccag agcgaggccg gtgagtgacc ccggcccggg gcgcaggtca       300
     cgacctctca tcccccacgg acgggccagg tcgcccacag tctccgggtc cgagatccgc       360
     cccgaagccg cgggaccccg agacccttgc cccgggagag gcccaggcgc ctttacccgg       420
     tttcattttc agtttaggcc aaaaatcccc ccaggttggt cggggcgggg cggggctcgg       480
     gggaccgggc tgaccgcggg gtccgggcca ggttctcaca ccgtccagag gatgtatggc       540
     tgcgacgtgg ggtcggactg gcgcttcctc cgcgggtacc accagtacgc ctacgacggc       600
     aaggattaca tcgccctgaa agaggacctg cgctcttgga ccgcggcgga catggcagct       660
     cagaccacca agcacaagtg ggaggcggcc catgtggcgg agcagttgag agcctacctg       720
     gagggcacgt gcgtggagtg gctccgcaga tacctggaga acgggaagga gacgctgcag       780
     cgcacgg                                                                 787