
EBI Dbfetch

ID   EF422359; SV 1; linear; genomic DNA; STD; HUM; 791 BP.
AC   EF422359;
DT   28-FEB-2007 (Rel. 90, Created)
DT   17-APR-2011 (Rel. 108, Last updated, Version 3)
DE   Homo sapiens MHC clas I antigen (HLA-C) gene, HLA-C*03 variant allele,
DE   exons 2, 3 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-791
RX   DOI; 10.1111/j.1744-313X.2008.00806.x.
RX   PUBMED; 19046303.
RA   Miao K.R., Pan Q.Q., Wu H.X., Zhou X.Y., Pan M., Xue M., Fan S., Wang X.Y.,
RA   Zhao X., Tang R.C., Wang C.Y.;
RT   "Unusual amplification pattern by SSP HLA-B typing led to discovery of a
RT   novel HLA-C allele";
RL   Int. J. Immunogenet. 35(6):447-451(2008).
RN   [2]
RP   1-791
RA   Miao K., Pan Q., Xue M., Fan S., Wang C.;
RT   "HLA C*03new in Chinese Han population";
RL   Unpublished.
RN   [3]
RP   1-791
RA   Wang C., Miao K., Xue M.;
RT   ;
RL   Submitted (04-FEB-2007) to the INSDC.
RL   HLA Lab, The First Affiliated Hospital of Nanjing Medical University, 300
RL   Guangzhou Road, Nanjing, Jiangsu 210029, China
DR   MD5; a25718bc83afb1c62243625d85a5d03c.
FH   Key             Location/Qualifiers
FT   source          1..791
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /pop_variant="Han Chinese"
FT                   /PCR_primers="fwd_name: C FORWARD, fwd_seq:
FT                   agcgaggkgccckcccggcga, rev_name: C REVERSE, rev_seq:
FT                   ggagatggggaaggctccccact"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>791
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*03 variant"
FT   mRNA            join(<1..270,516..>791)
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*03 variant"
FT                   /product="MHC clas I antigen"
FT   CDS             join(<1..270,516..>791)
FT                   /codon_start=3
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*03 variant"
FT                   /product="MHC clas I antigen"
FT                   /note="major histocompatibility complex"
FT                   /db_xref="GOA:A3RKP1"
FT                   /db_xref="IMGT/HLA:C*03:39"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:A3RKP1"
FT                   /protein_id="ABN79858.1"
FT                   VEWLRRYLKNGKETLQRA"
FT   exon            1..270
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*03 variant"
FT                   /number=2
FT   exon            516..791
FT                   /gene="HLA-C"
FT                   /allele="HLA-C*03 variant"
FT                   /number=3
SQ   Sequence 791 BP; 143 A; 256 C; 285 G; 107 T; 0 other;
     gctcccactc catgaggtat ttcgacaccg ccgtgtcccg gcccggccgc ggagagcccc        60
     gcttcatctc agtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagtccgag aggggagccg cgggcgccgt gggtggagca ggaggggccg gagtattggg       180
     accgggagac acagaagtac aagcgccagg cacagactga ccgagtgagc ctgcggaacc       240
     tgcgcggcta ctacaaccag agcgaggcca gtgagtgacc ccggcccggg gcgcaggtca       300
     cgacccctcc tcatccccca cggacggccc gggtcgcccc aagtctcccg gtctgagatc       360
     caccccgagg ctgcggaacc cgcccagacc ctcgaccgga gagagcccca gtcaccttta       420
     cccggtttca ttttcagttt aggccaaaat ccccgcgggt tggtcggggc ggggcggggc       480
     tcgggggacg gggctgaccg cgggggcggg gccagggtct cacatcatcc agaggatgta       540
     tggctgcgac gtggggcccg acgggcgcct cctccgcggg tatgaccagt acgcctacga       600
     cggcaaggat tacatcgccc tgaacgagga tctgcgctcc tggaccgccg cggacacggc       660
     ggctcagatc acccagcgca agtgggaggc ggcccgtgag gcggagcagc tgagagccta       720
     cctggagggc ctgtgcgtgg agtggctccg cagatacctg aagaatggga aggagacgct       780
     gcagcgcgcg g                                                            791
