
EBI Dbfetch

ID   DQ658416; SV 1; linear; genomic DNA; STD; HUM; 269 BP.
AC   DQ658416;
DT   25-SEP-2006 (Rel. 89, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 3)
DE   Homo sapiens MHC class II antigen (HLA-DRB1) gene, HLA-DRB1*1302variant
DE   allele, exon 2 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-269
RA   Anand A., Davey S., Brown C.;
RT   "A novel HLA-DRB1*1302 allele detected by sequence-based typing in a cord
RT   blood donation";
RL   Unpublished.
RN   [2]
RP   1-269
RA   Anand A., Davey S., Brown C.;
RT   ;
RL   Submitted (25-APR-2006) to the INSDC.
RL   Histocompatibility and Immunogenetics, National Blood Service, Colindale
RL   Avenue, London NW9 5BG, United Kingdom
DR   MD5; 3310bbeb6bdaa0e9033fc8b5d09e9491.
FH   Key             Location/Qualifiers
FT   source          1..269
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: gtgggcgttgcggcggc, rev_seq:
FT                   caggaaacagctatgaccacacacacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   gene            <1..>269
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1302variant"
FT   mRNA            <1..>269
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1302variant"
FT                   /product="MHC class II antigen"
FT   CDS             <1..>269
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1302variant"
FT                   /product="MHC class II antigen"
FT                   /db_xref="GOA:Q06RK2"
FT                   /db_xref="IMGT/HLA:DRB1*13:02:03"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:Q06RK2"
FT                   /protein_id="ABI84243.1"
FT   exon            1..>269
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*1302variant"
FT                   /number=2
SQ   Sequence 269 BP; 58 A; 65 C; 96 G; 50 T; 0 other;
     cacgtttctt ggagtactct acgtctgagt gtcatttctt caatgggacg gagcgggtgc        60
     ggttcctgga cagatacttc cataaccagg aggagaacgt gcgcttcgac agcgacgtgg       120
     gggagttccg ggcggtgacg gagctggggc ggcctgacgc tgagtactgg aacagccaga       180
     aggacatcct ggaagacgag cgggccgcgg tggacaccta ctgcagacac aactacgggg       240
     ttggtgagag cttcacagtg cagcggcga                                         269
