
ID   DQ364132; SV 1; linear; genomic DNA; STD; HUM; 1404 BP.
AC   DQ364132;
DT   06-FEB-2006 (Rel. 86, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 4)
DE   Homo sapiens MHC class I antigen (HLA) gene, HLA-B*15XX allele, exons 1
DE   through 3 and partial cds.
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1404
RX   DOI; 10.1111/j.1399-0039.2006.00669.x.
RX   PUBMED; 17026471.
RA   Chen Q., Zou H., Xu X.H., Luo M., Wang J., Zuo Y.Q., Chen Y.H., Chen X.H.,
RA   Chen X.L., Yao Z.Q., Song N., Zeng J., Mi X.Y., Sun S.X., Wang J.X.,
RA   Zhao T.M.;
RT   "Characterization of HLA-B*5516, -B*1313, -B*9512, and -DRB1*1457 alleles
RT   identified in a southwest Chinese population";
RL   Tissue Antigens 68(4):339-343(2006).
RN   [2]
RP   1-1404
RA   Chen Q., Zou H., Xu X.-H., Luo M., Chen X.-H., Zuo Y.-Q., Chen Y.-H.,
RA   Yang J., Wang J.-X., Zhao T.-M.;
RT   "Identification of a novel allele HLA-B15XX in a Chinese family";
RL   Unpublished.
RN   [3]
RP   1-1404
RA   Chen Q., Zou H., Xu X.-H., Luo M., Chen X.-H., Zuo Y.-Q., Chen Y.-H.,
RA   Yang J., Wang J.-X., Zhao T.-M.;
RT   ;
RL   Submitted (15-JAN-2006) to the INSDC.
RL   MCIGS, NIAID, National Institutes of Health, Bldg. 55, Rm 5511, 50 South
RL   Dr, Bethesda, MD 20892, USA
DR   MD5; 1fd7de49e6cfb839bd43329011908fd2.
FH   Key             Location/Qualifiers
FT   source          1..1404
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.31"
FT                   /mol_type="genomic DNA"
FT                   /clone="6060"
FT                   /PCR_primers="fwd_seq: atagtcgacgaggcctggtgtaggagaagagg,
FT                   rev_seq: atagaattcgctgctgcaggggtcaaag"
FT                   /db_xref="taxon:9606"
FT   gene            1..>1404
FT                   /gene="HLA"
FT                   /allele="HLA-B*15XX"
FT   mRNA            join(1..381,510..779,1025..>1300)
FT                   /gene="HLA"
FT                   /allele="HLA-B*15XX"
FT                   /product="MHC class I antigen"
FT   exon            1..381
FT                   /gene="HLA"
FT                   /allele="HLA-B*15XX"
FT                   /number=1
FT   5'UTR           1..308
FT                   /gene="HLA"
FT                   /allele="HLA-B*15XX"
FT   CDS             join(309..381,510..779,1025..>1300)
FT                   /codon_start=1
FT                   /gene="HLA"
FT                   /allele="HLA-B*15XX"
FT                   /product="MHC class I antigen"
FT                   /note="human leucocyte antigen B; antigen presenting
FT                   molecule"
FT                   /db_xref="IMGT/HLA:B*15:112"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="UniProtKB/TrEMBL:Q2HYG4"
FT                   /protein_id="ABC94580.1"
FT   exon            510..779
FT                   /gene="HLA"
FT                   /allele="HLA-B*15XX"
FT                   /number=2
FT   exon            1025..1300
FT                   /gene="HLA"
FT                   /allele="HLA-B*15XX"
FT                   /number=3
SQ   Sequence 1404 BP; 247 A; 457 C; 490 G; 210 T; 0 other;
     tgaggcctgg tgtaggagaa gagggatcag gacgaagtcc caggtcccgg acggggctct        60
     cagggtctca ggctccgaga gccttgtctg cattggggag gcgcagcgtt ggggattccc       120
     cactcccacg agtttcactt cttctcccaa cctatgtcgg gtccttcttc caggatactc       180
     gtgacgcgtc cccatttccc actcccattg ggtgtcgggt gtctagagaa gccaatcagt       240
     gtcgccgggg tcccagttct aaagtcccca cgcacccacc cggactcaga atctcctcag       300
     acgccgagat gcgggtcacg gcgccccgaa ccgtcctcct gctgctctcg ggagccctgg       360
     ccctgaccga gacctgggcc ggtgagtgcg ggtcgggagg gaaatggcct ctgtggggag       420
     gagcgagggg accgcaggcg ggggcgcagg acccggggag ccgcgccggg aggagggtcg       480
     ggcgggtctc agcccctcct cgcccccagg ctcccactcc atgaggtatt tctacaccgc       540
     catgtcccgg cccggccgcg gggagccccg cttcatcgca gtgggctacg tggacgacac       600
     ccagttcgtg aggttcgaca gcgacgccgc gagtccgagg atggcgcccc gggcgccatg       660
     gatagagcag gaggggccgg agtattggga ccggaacaca cagatctcca agaccaacac       720
     acagacttac cgagagagcc tgcggaacct gcgcggctac tacaaccaga gcgaggccgg       780
     tgagtgaccc cggcccgggg cgcaggtcac gactccccat cccccacgta cggcccgggt       840
     cgccccgagt ctccgggtcc gagatccgcc cccctgaggc cgcgggaccc gcccaaaccc       900
     tcgaccggcg agagccccag gcgcgtttac ccggtttcat tttcagttga ggccaaaatc       960
     cccgcgggtt ggtcggggcg gggcggggct cgggggacgg ggctgaccgc ggggccgggg      1020
     ccagggtctc acatcatcca caggatgtat ggctgcgacg tggggccgga cgggcgcctc      1080
     ctccgcgggt atgaccagtc cgcctacgac ggcaaggatt acatcgccct gaacgaggac      1140
     ctgagctcct ggaccgcggc ggacacggcg gctcagatca cccagcgcaa gtgggaggcg      1200
     gcccgtgagg cggagcagct gagagcctac ctggagggcc tgtgcgtgga gtggctccgc      1260
     agatacctgg agaacgggaa ggagacgctg cagcgcgcgg gtaccagggg cagtggggag      1320
     ccttccccat ctcctatagg tcgccgggga tggcctccca cgagaagagg aggaaaatgg      1380
     gatcagcgct agaatgtcgc cctc                                             1404