
EBI Dbfetch

ID   AM980943; SV 1; linear; genomic DNA; STD; HUM; 1423 BP.
AC   AM980943;
DT   14-APR-2008 (Rel. 95, Created)
DT   14-APR-2008 (Rel. 95, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*40new
DE   allele, exons 1-5
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1423
RA   Dormoy A.;
RT   ;
RL   Submitted (01-APR-2008) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Leisenbach R., Bert S., De Matteis M.;
RT   "The HLA-B*40new allele has 1 nucleotide change from the B*400201 allele at
RT   position 409 of exon 3 where C->T (codon 113 (CAT -> TAT) resulting in a
RT   change of amino acid : His -> Tyr.";
RL   Unpublished.
DR   MD5; 4639d3e5154964d3697a21cb7f2df564.
FH   Key             Location/Qualifiers
FT   source          1..1423
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: Ala G-20.2, fwd_seq:
FT                   gaggatgcgggtcacggcg, rev_name: P3' Exon 5B, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..59,189..458,659..934,976..1251,1345..>1423)
FT                   /codon_start=2
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:B2G3M3"
FT                   /db_xref="IMGT/HLA:B*40:89"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:B2G3M3"
FT                   /protein_id="CAQ37792.1"
FT   exon            <1..59
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40new"
FT                   /number=1
FT   intron          60..188
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40new"
FT                   /number=1
FT   exon            189..458
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40new"
FT                   /number=2
FT   intron          459..658
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40new"
FT                   /number=2
FT   exon            659..934
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40new"
FT                   /number=3
FT   intron          935..975
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40new"
FT                   /number=3
FT   exon            976..1251
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40new"
FT                   /number=4
FT   intron          1252..1344
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40new"
FT                   /number=4
FT   exon            1345..>1423
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*40new"
FT                   /number=5
SQ   Sequence 1423 BP; 263 A; 453 C; 495 G; 212 T; 0 other;
     gccccgaacc ctcctcctgc tgctctgggg ggcagtggcc ctgaccgaga cctgggctgg        60
     tgagtgcggg gtcggcaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg       120
     gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc       180
     gcccccaggc tcccactcca tgaggtattt ccacacctcc gtgtcccggc ccggccgcgg       240
     ggagccccgc ttcatcaccg tgggctacgt ggacgacacg ctgttcgtga ggttcgacag       300
     cgacgccacg agtccgagga aggagccgcg ggcgccatgg atagagcagg aggggccgga       360
     gtattgggac cgggagacac agatctccaa gaccaacaca cagacttacc gagagagcct       420
     gcggaacctg cgcggctact acaaccagag cgaggccggt gagtgacccc ggcccggggc       480
     gcaggtcacg actccccatc ccccacccga ggccgcggga cccgcccaga ccctcgaccg       540
     gcgagagccc caggcgcgtt tacccggttt cattttcagt tgaggccaaa atccccgcgg       600
     gttggtcggg gcggggcggg gctcgggggg acggggctga ccgcgggggc ggggccaggg       660
     tctcacaccc tccagagcat gtacggctgc gacgtggggc cggacgggcg cctcctccgc       720
     gggtataacc agtacgccta cgacggcaag gattacatcg ccctgaacga ggacctgcgc       780
     tcctggaccg ccgcggacac ggcggctcag atcacccagc gcaagtggga ggcggcccgt       840
     gtggcggagc agctgagagc ctacctggag ggcgagtgcg tggagtggct ccgcagatac       900
     ctggagaacg ggaaggagac gctgcagcgc gcgggtacca ggggcagcgc ctgattttct       960
     gactcttccc atcagacccc ccaaagacac acgtgaccca ccaccccatc tctgaccatg      1020
     aggccaccct gaggtgctgg gccctgggct tctaccctgc ggagatcaca ctgacctggc      1080
     agcgggatgg cgaggaccaa actcaggaca ctgagcttgt ggagaccaga ccagcaggag      1140
     atagaacctt ccagaagtgg gcagctgtgg tggtgccttc tggagaagag cagagataca      1200
     catgccatgt acagcatgag gggctgccga agcccctcac cctgagatgg ggtaaggagg      1260
     gggatgaggg gtcatatctc ttctcaggga aagcaggagc ccttcagcag ggtcagggcc      1320
     cctcatcttc ccttcctttc ccagagccgt cttcccagtc caccgtcccc atcgtgggca      1380
     ttgttgctgg cctggctgtc ctagcagttg tggtcatcgg agc                        1423
