
ID   AM950324; SV 1; linear; genomic DNA; STD; HUM; 1487 BP.
AC   AM950324;
DT   14-APR-2008 (Rel. 95, Created)
DT   14-APR-2008 (Rel. 95, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*52new
DE   allele, exons 2-7
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1487
RA   Dormoy A.;
RT   ;
RL   Submitted (01-APR-2008) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Pedron B., Bert S., Weschler B.;
RT   "The HLA-B*52new allele has 1 nucleotide change from the B*520101 allele at
RT   position 412 of exon 3 where G->A (codon 166 (GAC -> AAC)) resulting in a
RT   change of amino acid : Asp -> Asn";
RL   Unpublished.
DR   MD5; cc7447b4bbb8472bce08f9a55e3ffc0d.
FH   Key             Location/Qualifiers
FT   source          1..1487
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: Val G-8, fwd_seq:
FT                   caggaaacagctatgaccgctgctctggggggcag, rev_name: P3' Exon 5B,
FT                   rev_seq: gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   intron          <1..18
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*52new"
FT                   /number=1
FT   mRNA            join(<19..288,534..809,1156..>1431)
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*52new"
FT   CDS             join(<19..288,534..809,1156..>1431)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*52new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:B2G3G5"
FT                   /db_xref="IMGT/HLA:B*52:12"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:B2G3G5"
FT                   /protein_id="CAQ37791.1"
FT   exon            19..288
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*52new"
FT                   /number=2
FT   intron          289..533
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*52new"
FT                   /number=2
FT   exon            534..809
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*52new"
FT                   /number=3
FT   intron          810..1155
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*52new"
FT                   /number=3
FT   exon            1156..1431
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*52new"
FT                   /number=4
FT   intron          1431..>1487
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*52new"
FT                   /number=4
SQ   Sequence 1487 BP; 291 A; 468 C; 485 G; 243 T; 0 other;
     gcccctcctc gcccccaggc tcccactcca tgaggtattt ctacaccgcc atgtcccggc        60
     ccggccgcgg ggagccccgc ttcatcgcag tgggctacgt ggacgacacc cagttcgtga       120
     ggttcgacag cgacgccgcg agtccgagga cggagccccg ggcgccatgg atagagcagg       180
     aggggccgga gtattgggac cgggagacac agatctccaa gaccaacaca cagacttacc       240
     gagagaacct gcggatcgcg ctccgctact acaaccagag cgaggccggt gagtgacccc       300
     ggcccggggc gcaggtcacg actccccatc ccccacgtac ggcccgggtc gccccgagtc       360
     tccgggtccg agatccgcct ccctgaggcc gcgggacccg cccagaccct cgaccggcga       420
     gagccccagg cgcgtttacc cggtttcatt ttcagttgag gccaaaatcc ccgcgggttg       480
     gtcggggcgg ggcggggctc gggggacggt gctgaccgcg gggccggggc cagggtctca       540
     cacttggcag acgatgtatg gctgcgacgt ggggccggac gggcgcctcc tccgcgggca       600
     tgaccagtac gcctacgacg gcaaagatta catcgccctg aacgaggacc tgagctcctg       660
     gaccgcggcg gacaccgcgg ctcagatcac ccagcgcaag tgggaggcgg cccgtgaggc       720
     ggagcagctg agagcctacc tggagggcct gtgcgtggag tggctccgca gacacctgga       780
     gaacgggaag gagacgctgc agcgcgcggg taccaggggc agtggggagc cttccccatc       840
     tcctataggt cgccggggat ggcctcccac gagaagagga ggaaaatggg atcagcgcta       900
     gaatgtcgcc ctcccttgaa tggagaatgg catgagtttt cctgagtttc ctctgagggc       960
     cccctccgct cagagactcg aactttccaa tgaataggag attatcccag gtgcctgcgt      1020
     ccaggctggt gtctgggttc tgtgcccctt ccccacacca ggtgtcctgt ccattctcag      1080
     gctggtcaca tgggtggtcc tagggtgtcc catgagagat gcaaagcgcc tgaattttct      1140
     gactcttccc atcagacccc ccaaagacac acgtgaccca ccaccccgtc tctgaccatg      1200
     aggccaccct gaggtgctgg gccctgggct tctaccctgc ggagatcaca ctgacctggc      1260
     agcgggatgg cgaggaccaa actcaggaca ctgagcttgt ggagaccaga ccagcaggag      1320
     atagaacctt ccagaagtgg gcagctgtgg tggtgccttc tggagaagag cagagataca      1380
     catgccatgt acagcatgag gggctgccga agcccctcac cctgagatgg ggtaaggagg      1440
     gggatgaggg gtcatatctc ttctcaggga aagcaggagc ccttctg                    1487