
ID   AM931289; SV 1; linear; genomic DNA; STD; HUM; 988 BP.
AC   AM931289;
DT   08-JAN-2008 (Rel. 94, Created)
DT   08-JAN-2008 (Rel. 94, Last updated, Version 1)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*0742 allele,
DE   exons 1-3
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-988
RA   Hammond L.;
RT   ;
RL   Submitted (07-JAN-2008) to the INSDC.
RL   Hammond L., Tissue Typing, Molecular Genetics, New Zealand Blood Service,
RL   Private Bag 92071 Auckland Mail Centre, Auckland 1142, NEW ZEALAND.
RN   [2]
RA   Hammond L., Dunn P., Rantes C.;
RT   "Confirmatory sequence and serology of HLA-B*0742";
RL   Unpublished.
DR   MD5; 5e18a960a930a87df5d207e957c62126.
FH   Key             Location/Qualifiers
FT   source          1..988
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /isolate="4229311"
FT                   /mol_type="genomic DNA"
FT                   /cell_type="mixed leucocytes"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: 5B65, fwd_seq:
FT                   tggtcatggcgccccgaaccg, rev_name: 3B38, rev_seq:
FT                   ctggggaggaaacacaggtcagcatgggaac"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..69,198..467,713..>988)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*0742"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:B*07:42"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:B0BK95"
FT                   /protein_id="CAP62571.1"
FT   exon            <1..69
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*0742"
FT                   /number=1
FT   intron          70..197
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*0742"
FT                   /number=1
FT   exon            198..467
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*0742"
FT                   /number=2
FT   intron          468..712
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*0742"
FT                   /number=2
FT   exon            713..>988
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*0742"
FT                   /number=3
SQ   Sequence 988 BP; 167 A; 328 C; 367 G; 126 T; 0 other;
     tggtcatggc gccccgaacc gtcctcctgc tgctctcggc ggccctggcc ctgaccgaga        60
     cctgggccgg tgagtgcggg tcgggaggga aatggcctct gccgggagga gcgaggggac       120
     cgcaggcggg ggcgcaggac ctgaggagcc gcgccgggag gagggtcggg cgggtctcag       180
     cccctcctca cccccaggct cccactccat gaggtatttc tacacctccg tgtcccggcc       240
     cggccgcggg gagccccgct tcatctcagt gggctacgtg gacgacaccc agttcgtgag       300
     gttcgacagc gacgccgcga gtccgagaga ggagccgcgg gcgccgtgga tagagcagga       360
     ggggccggag tattgggacc ggaacacaca gatctacaag gcccaggcac agactgaccg       420
     agagagcctg cggaacctgc gcggctacta caaccagagc gaggccggtg agtgaccccg       480
     gcccggggcg caggtcacga ctccccatcc cccacgtacg gcccgggtcg ccccgagtct       540
     ccgggtccga gatccgcctc cctgaggccg cgggacccgc ccagaccctc gaccggcgag       600
     agccccaggc gcgtttaccc ggtttcattt tcagttgagg ccaaaatccc cgcgggttgg       660
     tcggggcggg gcggggctcg ggggactggg ctgaccgcgg ggccggggcc agggtctcac       720
     accctccaga gcatgtacgg ctgcgacgtg gggccggacg ggcgcctcct ccgcgggcat       780
     gaccagtacg cctacgacgg caaggattac atcgccctga acgaggacct gcgctcctgg       840
     accgccgcgg acacggcggc tcagatcacc cagcgcaagt gggaggcggc ccgtgaggcg       900
     gagcagcgga gagcctacct ggagggcgag tgcgtggagt ggctccgcag atacctggag       960
     aacgggaagg acaagctgga gagcgctg                                          988