
ID   AM911066; SV 1; linear; genomic DNA; STD; HUM; 1022 BP.
AC   AM911066;
DT   28-NOV-2007 (Rel. 93, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*51new
DE   allele, exons 2-4
KW   .
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1022
RA   Avinens O.;
RT   ;
RL   Submitted (19-NOV-2007) to the INSDC.
RL   Avinens O., Hopital Saint Eloi, Laboratoire immunologie, 80 avenue Augustin
RL   Fliche, 34295 Montpellier Cedex, FRANCE.
RN   [2]
RA   Avinens O., Eliaou J.F.;
RT   "New HLA-B*51 allele";
RL   Unpublished.
DR   MD5; 570bd2dcb7d2625d6bacdb01d0ffeeb3.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: int1t, fwd_seq: gggggcgcaggacctga,
FT                   rev_name: P3exon5B, rev_seq: gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..646,747..>1022)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51new"
FT                   /product="MHC class I anitgen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:B*53:14"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:A9J7N0"
FT                   /protein_id="CAP45723.1"
FT   exon            <1..270
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51new"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51new"
FT                   /number=3
FT   gap             647..746
FT                   /estimated_length=unknown
FT   exon            747..>1022
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51new"
FT                   /number=4
SQ   Sequence 1022 BP; 178 A; 263 C; 267 G; 114 T; 200 other;
     gctcccactc catgaggtat ttctacaccg ccatgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc agtgggctac gtggacgaca cccagttcgt gaggttcgac agcgacgccg       120
     cgagtccgag gacggagccc cgggcgccat ggatagagca ggaggggccg gagtattggg       180
     accggaacac acagatcttc aagaccaaca cacagactta ccgagagaac ctgcggatcg       240
     cgctccgcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacac cctccagagc atgtacggct gcgacctggg gcccgacggg       420
     cgcctcctcc gcgggcatga ccagtccgcc tacgacggca aggattacat cgccctgaac       480
     gaggacctga gctcctggac cgcggcggac accgcggctc agatcaccca gcgcaagtgg       540
     gaggcggccc gtgtggcgga gcagctgaga gcctacctgg agggcctgtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcgcggnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnaccc cccaaagaca cacgtgaccc accaccccgt       780
     ctctgaccat gaggccaccc tgaggtgctg ggccctgggc ttctaccctg cggagatcac       840
     actgacctgg cagcgggatg gcgaggacca aactcaggac actgagcttg tggagaccag       900
     accagcagga gatagaacct tccagaagtg ggcagctgtg gtggtgcctt ctggagaaga       960
     gcagagatac acatgccatg tacagcatga ggggctgccg aagcccctca ccctgagatg      1020
     gg                                                                     1022