
ID   AM887530; SV 1; linear; genomic DNA; STD; HUM; 498 BP.
AC   AM887530;
DT   29-OCT-2007 (Rel. 93, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-DPB1 gene for MHC class II antigen,
DE   HLA-DPB1*110101 allele, exon 2
KW   HLA-DPB1 gene; HLA-DPB1*110101 allele; major histocompatibility complex;
KW   MHC class II antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-498
RA   Vilches C.;
RT   ;
RL   Submitted (27-SEP-2007) to the INSDC.
RL   Vilches C., Inmunologia, H.U. Puerta de Hierro, San Martin de Porres no. 4,
RL   28035, SPAIN.
RN   [2]
RA   Vilches C.;
RT   "Complete exon 2 sequence of the HLA-DPB1*110101 allele";
RL   Unpublished.
DR   MD5; 0d29d40f873f496ec908d5827ad5730a.
DR   Ensembl-Gn; ENSG00000215048; homo_sapiens.
DR   Ensembl-Gn; ENSG00000223865; homo_sapiens.
DR   Ensembl-Gn; ENSG00000226826; homo_sapiens.
DR   Ensembl-Gn; ENSG00000230763; homo_sapiens.
DR   Ensembl-Gn; ENSG00000236693; homo_sapiens.
DR   Ensembl-Gn; ENSG00000237710; homo_sapiens.
DR   Ensembl-Tr; ENST00000399500; homo_sapiens.
DR   Ensembl-Tr; ENST00000411749; homo_sapiens.
DR   Ensembl-Tr; ENST00000418931; homo_sapiens.
DR   Ensembl-Tr; ENST00000425130; homo_sapiens.
DR   Ensembl-Tr; ENST00000433800; homo_sapiens.
DR   Ensembl-Tr; ENST00000454006; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..498
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /country="Spain"
FT                   /cell_line="H348"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: DPB-E2F 129, fwd_seq:
FT                   aggaccacagaactcggtactagga, rev_name: DPB-E2R+107, rev_seq:
FT                   tgaatccccaacccaaagtcccc"
FT                   /db_xref="taxon:9606"
FT   CDS             <129..>392
FT                   /codon_start=3
FT                   /gene="HLA-DPB1"
FT                   /allele="HLA-DPB1*110101"
FT                   /product="MHC class II antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:P04440"
FT                   /db_xref="HGNC:HGNC:4940"
FT                   /db_xref="IMGT/HLA:DPB1*11:01:01"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="PDB:3LQZ"
FT                   /db_xref="PDB:4P4K"
FT                   /db_xref="PDB:4P4R"
FT                   /db_xref="PDB:4P57"
FT                   /db_xref="PDB:4P5K"
FT                   /db_xref="PDB:4P5M"
FT                   /db_xref="UniProtKB/Swiss-Prot:P04440"
FT                   /protein_id="CAP08783.1"
FT   exon            129..392
FT                   /gene="HLA-DPB1"
FT                   /allele="HLA-DPB1*110101"
FT                   /number=2
SQ   Sequence 498 BP; 114 A; 126 C; 179 G; 79 T; 0 other;
     aaactcctat tttaaaatcc agccctgagt gggaagattt gggaagaatc gttaatattg        60
     agagagagag ggagaaagag gattagatga gagtggcgcc tccgctcatg tccgccccct       120
     ccccgcagag aattacgtgt accagttacg gcaggaatgc tacgcgttta atgggacaca       180
     gcgcttcctg gagagataca tctacaaccg gcaggagtac gcgcgcttcg acagcgacgt       240
     gggagagttc cgggcggtga cggagctggg gcggcctgct gcggagtact ggaacagcca       300
     gaaggacctc ctggaggaga ggcgggcagt gccggacagg atgtgcagac acaactacga       360
     gctggacgag gccgtgaccc tgcagcgccg aggtgagtga gggctttggg ccggcggtcc       420
     cagggcagcc ccgcgggccc gtgcccaggg cgcaggagca gccgggttgg cctaagggac       480
     cttagtgccg ggcggaaa                                                     498