
EBI Dbfetch

ID   AM884150; SV 1; linear; genomic DNA; STD; HUM; 646 BP.
AC   AM884150;
DT   11-SEP-2007 (Rel. 93, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-Cw gene for MHC class I antigen, HLA-Cw*07new
DE   allele, exons 2-3
KW   HLA-Cw gene; HLA-Cw*07new allele; human leucocyte antigen Cw;
KW   major histocompatibility complex; MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-646
RA   Schwab S.;
RT   ;
RL   Submitted (10-SEP-2007) to the INSDC.
RL   Schwab S., Immunogenetics, Laboratory for Medical Genetics, Lochhamer Str.
RL   29, 82152 Martinsried, GERMANY.
RN   [2]
RA   Schwab S., Woelpl A., Klein H.;
RT   "Detection of a novel HLA-Cw*07 variant in a German bone marrow donor.";
RL   Unpublished.
DR   MD5; 966d9dc2d3f2cee35416e6dc1e2c24ee.
FH   Key             Location/Qualifiers
FT   source          1..646
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /country="Germany"
FT                   /dev_stage="adult"
FT                   /cell_type="leucocyte"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: 96024, fwd_seq:
FT                   agcgaggkgcccgcccggcga, rev_name: 96154, rev_seq:
FT                   ctgctgcagtggtcaaagtg"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..>646)
FT                   /codon_start=3
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*07new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:A7WPR6"
FT                   /db_xref="IMGT/HLA:C*07:53"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:A7WPR6"
FT                   /protein_id="CAP03413.1"
FT                   VEWLRRYLENGKETLQRA"
FT   exon            1..270
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*07new"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*07new"
FT                   /number=3
SQ   Sequence 646 BP; 106 A; 174 C; 197 G; 69 T; 100 other;
     gctcccactc catgaggtat ttcgacaccg ccgtgtcccg gcccggccgc ggagagcccc        60
     gcttcatctc agtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagtccgag aggggagccg cgggcgccgt gggtggagca ggaggggccg gagtattggg       180
     accgggagac acagaactac aagcgccagg cacaggctga ccgagtgagc ctgcggaacc       240
     tgcgcggcta ctacaaccag agcgaggacg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn ggtctcacac cctccagagg atgtatggct gcgacctggg gcccgacggg       420
     cgcctcctcc gcgggtatga ccagtccgcc tacgacggca aggattacat cgccctgaac       480
     gaggacctgc gctcctggac cgccgcggac accgcggctc agatcaccca gcgcaagttg       540
     gaggcggccc gtgcggcgga gcagcagaga gcctacctgg agggcacgtg cgtggagtgg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcgcag                      646
