
ID   AM850146; SV 1; linear; genomic DNA; STD; HUM; 2663 BP.
AC   AM850146;
DT   06-SEP-2007 (Rel. 93, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-C gene for MHC class I antigen, HLA-Cw*07new
DE   allele, exons 1-7
KW   HLA-C gene; HLA-Cw*07new allele; human leucocyte antigen Cw;
KW   major histocompatability complex; MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-2663
RA   Dormoy A.;
RT   ;
RL   Submitted (30-AUG-2007) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Froelich N., Leisenbach R.;
RT   "The Cw*07 new allele has 1 nt change from Cw*0701 where T is found in
RT   place of C leading to the change of the codon GTC (Val) in place of GCC
RT   (Ala)";
RL   Unpublished.
DR   MD5; 102d960d897a0f819b13396db5246b4b.
FH   Key             Location/Qualifiers
FT   source          1..2663
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: Gly G-9, fwd_seq:
FT                   ctgctgctctcgggaggcc, rev_name: P3' UT (B+C), rev_seq:
FT                   aaatcctgcatctcagtccca"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..26,157..426,677..952,1540..1815,1905..2032,
FT                   2437..2469,2577..>2663)
FT                   /codon_start=2
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:A7WPJ2"
FT                   /db_xref="IMGT/HLA:C*07:52"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:A7WPJ2"
FT                   /protein_id="CAO99143.1"
FT   exon            <1..26
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=1
FT   intron          27..156
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=1
FT   exon            157..426
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=2
FT   intron          427..676
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=2
FT   exon            677..952
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=3
FT   intron          953..1539
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=3
FT   exon            1540..1815
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=4
FT   variation       1588
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*0701"
FT                   /replace="c"
FT                   /compare=D83957.1
FT                   /note="Val -> Ala"
FT   intron          1816..1904
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=4
FT   exon            1905..2032
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=5
FT   intron          2033..2436
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=5
FT   exon            2437..2469
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=6
FT   intron          2470..2576
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=6
FT   exon            2577..>2663
FT                   /gene="HLA-C"
FT                   /allele="HLA-Cw*07new"
FT                   /number=7
SQ   Sequence 2663 BP; 502 A; 781 C; 854 G; 526 T; 0 other;
     cctggccctg accgagacct gggcctgtga gtgcggggtt gggagggaag cggcctctgc        60
     ggagaggagc gaggggcccg cccggcgagg gcgcaggacc cggggagccg cgcagggagg       120
     tgggtcgggc gggtctcagc ccctcctcgc ccccaggctc ccactccatg aggtatttcg       180
     acaccgccgt gtcccggccc ggccgcggag agccccgctt catctcagtg ggctacgtgg       240
     acgacacgca gttcgtgcgg ttcgacagcg acgccgcgag tccgagaggg gagccgcggg       300
     cgccgtgggt ggagcaggag gggccggagt attgggaccg ggagacacag aactacaagc       360
     gccaggcaca ggctgaccga gtgagcctgc ggaacctgcg cggctactac aaccagagcg       420
     aggacggtga gtgaccccgg cccggggcgc aggtcacgac ccctccccat cccccacgga       480
     cggcccgggt cgccccgagt ctccccgtct gagatccacc ccaaggtgga tctgcggaac       540
     ccgcccagac cctcgaccgg agagagcccc agtcgccttt acccggtttc attttcggtt       600
     taggccaaaa tccccgcggg ttggtcgggg cggggcgggg ctcgggggac tgggctgacc       660
     gcgggggcgg ggccagggtc tcacaccctc cagaggatgt atggctgcga cctggggccc       720
     gacgggcgcc tcctccgcgg gtatgaccag tccgcctacg acggcaagga ttacatcgcc       780
     ctgaacgagg acctgcgctc ctggaccgcc gcggacaccg cggctcagat cacccagcgc       840
     aagttggagg cggcccgtgc ggcggagcag ctgagagcct acctggaggg cacgtgcgtg       900
     gagtggctcc gcagatacct ggagaacggg aaggagacgc tgcagcgcgc aggtaccagg       960
     ggcagtgggg agccttcccc atctcctata gatctcccgg gatggcctcc cacgaggagg      1020
     ggaggaaaat gggatcagca ctggaatatc gccctccctt gaatggagaa tggcatgagt      1080
     tttcctgagt ttcctctgag ggccccctct gctctctagg acaattaagg gatgaagtct      1140
     ctgaggaaat ggaggggaag acagtccctg gaatactgat caggggtctc ctttgaccac      1200
     tttgaccact gcagcagctg tggtcaggct gctgaccttt ctctcaggcc ttgttctctg      1260
     cctcacactc aatgtgtctg aaggtttgat tccagctttt ctgagtcctg cagcctccac      1320
     tcaggtcagg accagaagtc gctgttcctc cctcagagac tagaactttc caatgaatag      1380
     gagattatcc caggtgcctg tgtccaggct ggcgtctggg ttctgtgccg ccttccccac      1440
     cccaggtgtc ctgtccattc tcaggatggt cacatgggcg ctgctggagt gtcccaagag      1500
     agatgcaaag tgtctgaatt ttctgactct tcccgtcaga acccccaaag acacacgtga      1560
     cccaccaccc cctctctgac catgaggtca ccctgaggtg ctgggccctg ggcttctacc      1620
     ctgcggagat cacactgacc tggcagcggg atggggagga ccagacccag gacaccgagc      1680
     ttgtggagac caggccagca ggagatggaa ccttccagaa gtgggcagct gtggtggtgc      1740
     cttctggaca agagcagaga tacacgtgcc atatgcagca cgaggggctg caagagcccc      1800
     tcaccctgag ctggggtaag gaggggaatg gggggtcaca tctcttatca gagaaagcag      1860
     aagtccttct ggagcccttc agccgggtca gggctgaggc ttccagccat cttcccagcc      1920
     caccatcccc atcatgggca tcgttgctgg cctggctgtc ctggttgtcc tagctgtcct      1980
     tggagctgtg gtcaccgcta tgatgtgtag gaggaagagc tcaggtaggg aaggggtgaa      2040
     gagcggggtc tgggttttct tgtcccactg ggagtttcaa gccccaggta gaagtgtgcc      2100
     ccgccttgtt actggaagca ccatccacac atgggccatc ccagcctggg accctgtgtg      2160
     ccagcactta ctcttttgtg aagcacatgt gacaatgaag gacggatgta tcaccttgat      2220
     gattatggtg ttggggtcct gattccagca ttcatgagtc aggggaaggt ccctgctaag      2280
     gacagacctt aggagggcag ttggtccaga acccacaact gctttcccca tgtttcctga      2340
     tcctgccctg ggtctgcagt cgtagttctg gaaacttctc ttgggtccaa gactaggagg      2400
     ttccccgtcc cctcataggg cattttcttc ccacaggtgg aaaaggaggg agctgctctc      2460
     aggctgcgtg taagtgatgg cggcgggcgt gtggaggagc tcacctactc cataattcct      2520
     cttgtcccac atctcctgcg ggctctgacc aggtcttttt ttttgttcta ccccaggcag      2580
     caacagtgcc cagggctctg atgagtctct catcacttgt aaaggtgaga ttctggggag      2640
     ctgaagtggt cgggggtggg gca                                              2663