
ID   AM689936; SV 1; linear; genomic DNA; STD; HUM; 1440 BP.
AC   AM689936;
DT   06-APR-2007 (Rel. 91, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*07new
DE   allele, exons 1-5
KW   HLA-B gene. HLA-B*07new allele; human leucocyte antigen B;
KW   major histocompatibility complex; MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1440
RA   Dormoy A.;
RT   ;
RL   Submitted (02-APR-2007) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Froelich N., Weschler B.;
RT   "The HLA-B*07new allele has 1 nucleotide change from B*070201 allele at
RT   position 302 where G->A (codon 77 (AGC ->AAC) resulting in a coding change
RT   , 77Ser is changed to Asn.";
RL   Unpublished.
DR   MD5; b7583f591c99cb9aa1ec3f27f3fd0f18.
FH   Key             Location/Qualifiers
FT   source          1..1440
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: Ala G-20.1, fwd_seq:
FT                   gaggatgctggtcatggcg, rev_name: P3' Exon 5B, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..63,192..461,707..982,1029..1304,1398..>1440)
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*07new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:B*07:57"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:A4Q972"
FT                   /protein_id="CAM84028.1"
FT   exon            <1..63
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*07new"
FT                   /number=1
FT   intron          64..191
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*07new"
FT                   /number=1
FT   exon            192..461
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*07new"
FT                   /number=2
FT   intron          462..706
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*07new"
FT                   /number=2
FT   exon            707..982
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*07new"
FT                   /number=3
FT   intron          983..1028
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*07new"
FT                   /number=3
FT   exon            1029..1304
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*07new"
FT                   /number=4
FT   intron          1305..1397
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*07new"
FT                   /number=4
FT   exon            1398..>1440
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*07new"
FT                   /number=5
SQ   Sequence 1440 BP; 264 A; 470 C; 497 G; 209 T; 0 other;
     tggcgccccg aaccgtcctc ctgctgctct cggcggccct ggccctgacc gagacctggg        60
     ccggtgagtg cgggtcggga gggaaatggc ctctgccggg aggagcgagg ggaccgcagg       120
     cgggggcgca ggacctgagg agccgcgccg ggaggagggt cgggcgggtc tcagcccctc       180
     ctcaccccca ggctcccact ccatgaggta tttctacacc tccgtgtccc ggcccggccg       240
     cggggagccc cgcttcatct cagtgggcta cgtggacgac acccagttcg tgaggttcga       300
     cagcgacgcc gcgagtccga gagaggagcc gcgggcgccg tggatagagc aggaggggcc       360
     ggagtattgg gaccggaaca cacagatcta caaggcccag gcacagactg accgagagaa       420
     cctgcggaac ctgcgcggct actacaacca gagcgaggcc ggtgagtgac cccggcccgg       480
     ggcgcaggtc acgactcccc atcccccacg tacggcccgg gtcgccccga gtctccgggt       540
     ccgagatccg cctccctgag gccgcgggac ccgcccagac cctcgaccgg cgagagcccc       600
     aggcgcgttt acccggtttc attttcagtt gaggccaaaa tccccgcggg ttggtcgggg       660
     cggggcgggg ctcgggggac tgggctgacc gcggggccgg ggccagggtc tcacaccctc       720
     cagagcatgt acggctgcga cgtggggccg gacgggcgcc tcctccgcgg gcatgaccag       780
     tacgcctacg acggcaagga ttacatcgcc ctgaacgagg acctgcgctc ctggaccgcc       840
     gcggacacgg cggctcagat cacccagcgc aagtgggagg cggcccgtga ggcggagcag       900
     cggagagcct acctggaggg cgagtgcgtg gagtggctcc gcagatacct ggagaacggg       960
     aaggacaagc tggagcgcgc tggtaccagg ggcaggggga gcctcccttt tctgactctt      1020
     cccatcagac cccccaaaga cacacgtgac ccaccacccc atctctgacc atgaggccac      1080
     cctgaggtgc tgggccctgg gtttctaccc tgcggagatc acactgacct ggcagcggga      1140
     tggcgaggac caaactcagg acactgagct tgtggagacc agaccagcag gagatagaac      1200
     cttccagaag tgggcagctg tggtggtgcc ttctggagaa gagcagagat acacatgcca      1260
     tgtacagcat gaggggctgc cgaagcccct caccctgaga tggggtaagg agggggatga      1320
     ggggtcatat ctcttctcag ggaaagcagg agcccttcag cagggtcagg gcccctcatc      1380
     ttcccctcct ttcccagagc cgtcttccca gtccaccgtc cccatcgtgg gcattgttgc      1440