
ID   AM689935; SV 1; linear; genomic DNA; STD; HUM; 1424 BP.
AC   AM689935;
DT   06-APR-2007 (Rel. 91, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*27new
DE   allele, exons 1-5
KW   HLA-B gene. HLA-B*27new allele; human leucocyte antigen B;
KW   major histocompatibility complex; MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1424
RA   Dormoy A.;
RT   ;
RL   Submitted (02-APR-2007) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Froelich N., Lafarge X.;
RT   "The new HLA-B*27 allele is identical to the current B*270502 allele except
RT   for the 2 positions 559 and 560 of exon 3 where CT is found in place of GA
RT   leading to the change of amino acid 163 Glu -> Leu";
RL   Unpublished.
DR   MD5; a6568b46c634f21a172df267dd0caa41.
FH   Key             Location/Qualifiers
FT   source          1..1424
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: Ala G-20.2, fwd_seq:
FT                   gaggatgcgggtcacggcg, rev_name: Exon 5B, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..59,189..458,703..978,1008..1283,1377..>1424)
FT                   /codon_start=2
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27new"
FT                   /product="MHC class I antigen"
FT                   /function="Peptide presentation"
FT                   /db_xref="IMGT/HLA:B*27:38"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:A4Q971"
FT                   /protein_id="CAM84027.1"
FT   exon            <1..59
FT                   /gene="HLA-B"
FT                   /allele="HLA-B"
FT                   /number=1
FT   intron          60..188
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27new"
FT                   /number=1
FT   exon            189..458
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27new"
FT                   /number=2
FT   intron          459..702
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27new"
FT                   /number=2
FT   exon            703..978
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27new"
FT                   /number=3
FT   intron          979..1007
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27new"
FT                   /number=3
FT   exon            1008..1283
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27new"
FT                   /number=4
FT   intron          1284..1376
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27new"
FT                   /number=4
FT   exon            1377..>1424
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*27new"
FT                   /number=5
SQ   Sequence 1424 BP; 256 A; 461 C; 500 G; 207 T; 0 other;
     gccccgaacc ctcctcctgc tgctctgggg ggcagtggcc ctgaccgaga cctgggctgg        60
     tgagtgcggg gtcggcaggg aaatggcctc tgtggggagg agcgagggga ccgcaggcgg       120
     gggcgcagga cccggggagc cgcgccggga ggagggtcgg gcgggtctca gcccctcctc       180
     gcccccaggc tcccactcca tgaggtattt ccacacctcc gtgtcccggc ccggccgcgg       240
     ggagccccgc ttcatcaccg tgggctacgt ggacgacacg ctgttcgtga ggttcgacag       300
     cgacgccgcg agtccgagag aggagccgcg ggcgccgtgg atagagcagg aggggccgga       360
     gtattgggac cgggagacac agatctgcaa ggccaaggca cagactgacc gagaggacct       420
     gcggaccctg ctccgctact acaaccagag cgaggccggt gagtgacccc ggcccggggc       480
     gcaggtcacg actccccatc ccccacgtac ggcccgggtc gccccgagtc tccgggtccg       540
     agatccgccc ccgaggccgc gggacccgcc cagaccctcg accggcgaga gccccaggcg       600
     cgtttacccg gtttcatttt cagttgaggc caaaatcccc gcgggttggt cggggcgggg       660
     cggggctcgg ggggacgggg ctgaccgcgg gggcggggcc agggtctcac accctccaga       720
     atatgtatgg ctgcgacgtg gggccggacg ggcgcctcct ccgcgggtac caccaggacg       780
     cctacgacgg caaggattac atcgccctga acgaggacct gagctcctgg accgccgcgg       840
     acacggcggc tcagatcacc cagcgcaagt gggaggcggc ccgtgtggcg gagcagctga       900
     gagcctacct ggagggcctg tgcgtggagt ggctccgcag atacctggag aacgggaagg       960
     agacgctgca gcgcgcgggt accaggggtt ctgactcttc ccatcagacc ccccaaagac      1020
     acacgtgacc caccacccca tctctgacca tgaggccacc ctgaggtgct gggccctggg      1080
     cttctaccct gcggagatca cactgacctg gcagcgggat ggcgaggacc aaactcagga      1140
     cactgagctt gtggagacca gaccagcagg agatagaacc ttccagaagt gggcagctgt      1200
     ggtggtgcct tctggagaag agcagagata cacatgccat gtacagcatg aggggctgcc      1260
     gaagcccctc accctgagat ggggtaagga gggggatgag gggtcatatc tcttctcagg      1320
     gaaagcagga gcccttcagc agggtcaggg cccctcatct tcccttcctt tcccagagcc      1380
     gtcttcccag tccaccgtcc ccatcgtggg cattgttgct ggcc                       1424