
ID   AM493902; SV 1; linear; genomic DNA; STD; HUM; 1022 BP.
AC   AM493902;
DT   22-FEB-2007 (Rel. 90, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-A gene for MHC class I antigen, HLA-A*23new
DE   allele, exons 2-4
KW   HLA-A gene; HLA-A*23new allele; human leucocyte antigen A;
KW   major histocompatibility complex; MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1022
RA   Avinens O.;
RT   ;
RL   Submitted (11-JAN-2007) to the INSDC.
RL   Avinens O., Laboratoire Immunologie, CHU Saint Eloi Montpellier,
RL   Montpellier Ce, 34295 Cedex 5, FRANCE.
RN   [2]
RA   Avinens O., Eliaou J.F.;
RT   "New A*23 allele";
RL   Unpublished.
DR   MD5; 111646355d9591171fcf6d91f18205c0.
FH   Key             Location/Qualifiers
FT   source          1..1022
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: ALAA1, fwd_seq: tgacccagacctgggca,
FT                   rev_name: Aex5, rev_seq: aggccagcaatgatgcccacgatg"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..270,371..646,747..>1022)
FT                   /codon_start=3
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*23new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:A*23:16"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:A2VC06"
FT                   /protein_id="CAM35492.1"
FT   exon            1..270
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*23new"
FT                   /number=2
FT   gap             271..370
FT                   /estimated_length=unknown
FT   exon            371..646
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*23new"
FT                   /number=3
FT   gap             647..746
FT                   /estimated_length=unknown
FT   exon            747..1022
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*23new"
FT                   /number=4
SQ   Sequence 1022 BP; 171 A; 250 C; 279 G; 122 T; 200 other;
     gctcccactc catgaggtat ttctccacat ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc cgtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagccagag gatggagccg cgggcgccgt ggatagagca ggaggggccg gagtattggg       180
     acgaggagac agggaaagtg aaggcccact cacagactga ccgagagaac ctgcggatcg       240
     cgctccgcta ctacaaccag agcgaggccg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
     nnnnnnnnnn gttctcacac cctccagatg atgtttggct gcgacatggg gtcggacggg       420
     cgcttcctcc gcgggtacca ccagtacgcc tacgacggca aggattacat cgccctgaaa       480
     gaggacctgc gctcttggac cgcggcggac atggcggctc agatcaccca gcgcaagtgg       540
     gaggcggccc gtgtggcgga gcagttgaga gcctacctgg agggcacgtg cgtggacggg       600
     ctccgcagat acctggagaa cgggaaggag acgctgcagc gcacggnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       720
     nnnnnnnnnn nnnnnnnnnn nnnnnnaccc ccccaagaca catatgaccc accaccccat       780
     ctctgaccat gaggccactc tgagatgctg ggccctgggc ttctaccctg cggagatcac       840
     actgacctgg cagcgggatg gggaggacca gacccaggac acggagcttg tggagaccag       900
     gcctgcaggg gatggaacct tccagaagtg ggcagctgtg gtggtacctt ctggagagga       960
     gcagagatac acctgccatg tgcagcatga gggtctgccc aagcccctca ccctgagatg      1020
     gg                                                                     1022