
ID   AM493681; SV 1; linear; genomic DNA; STD; HUM; 822 BP.
AC   AM493681;
DT   19-FEB-2007 (Rel. 90, Created)
DT   10-DEC-2009 (Rel. 103, Last updated, Version 2)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*51 allele,
DE   exons 2-4
KW   HLA-B gene; HLA-B*51 allele; major histocompatibility complex;
KW   MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-822
RA   Dubois V.;
RT   ;
RL   Submitted (16-FEB-2007) to the INSDC.
RL   Dubois V., HLA Laboratory, Efs Rhone Alpes, 1 et 3 rue du vercors, 69007
RL   Lyon, FRANCE.
RN   [2]
RX   DOI; 10.1111/j.1399-0039.2009.01386.x.
RX   PUBMED; 19845914.
RA   Dubois V., Favre-Victoire I., Giannoli C.;
RT   "Three new HLA-B alleles determined by sequence-based typing: B*9551,
RT   B*5161 and B*5317";
RL   Tissue Antigens 74(6):546-547(2009).
DR   MD5; 551c7135faf6fd37f15d8867ef647b42.
FH   Key             Location/Qualifiers
FT   source          1..822
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /sex="male"
FT                   /PCR_primers="fwd_name: 5' intron 1 B (TA), fwd_seq:
FT                   gggggcgcaggacctga, rev_name: P3' EXON 5B, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..>822
FT                   /codon_start=3
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*51"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:B*51:61:01"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="UniProtKB/TrEMBL:A2VBZ9"
FT                   /protein_id="CAM35422.1"
SQ   Sequence 822 BP; 182 A; 254 C; 271 G; 115 T; 0 other;
     gctcccactc catgaggtat ttctacaccg ccatgtcccg gcccggccgc ggggagcccc        60
     gcttcattgc agtgggctac gtggacgaca cccagttcgt gaggttcgac agcgacgccg       120
     cgagtccgag gacggagccc cgggcgccat ggatagagca ggaggggccg gagtattggg       180
     accggaacac acagatcttc aagaccaaca cacagactta ccgagagaac ctgcggatcg       240
     cgctccgcta ctacaaccag agcgaggccg ggtctcacac ttggcagacg atgtatggct       300
     gcgacgtggg gccggacggg cgcctcctcc gcgggcataa ccagtacgcc tacgacggca       360
     aagattacat cgccctgaac gaggacctga gctcctggac cgcggcggac acggcggctc       420
     agatcaccca gcgcaagtgg gaggcggccc gtgaggcgga gcagtggaga gcctacctgg       480
     agggcctgtg cgtggagtgg ctccgcagac acctggagaa cgggaaggag acgctgcagc       540
     gcgcggaccc cccaaagaca cacgtgaccc accaccccgt ctctgaccat gaggccaccc       600
     tgaggtgctg ggccctgggc ttctaccctg cggagatcac actgacctgg cagcgggatg       660
     gcgaggacca aactcaggac actgagcttg tggagaccag accagcagga gatagaacct       720
     tccagaagtg ggcagctgtg gtggtgcctt ctggagaaga gcagagatac acatgccatg       780
     tacagcatga ggggctgccg aagcccctca ccctgagatg gg                          822