
ID   AM493680; SV 1; linear; genomic DNA; STD; HUM; 822 BP.
AC   AM493680;
DT   19-FEB-2007 (Rel. 90, Created)
DT   19-FEB-2007 (Rel. 90, Last updated, Version 1)
DE   Homo sapiens partial HLA-A gene for MHC class I antigen, HLA-A*29 allele,
DE   exons 2-4
KW   HLA-A gene; HLA-A*29 allele; major histocompatibility complex;
KW   MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-822
RA   Dubois V.;
RT   ;
RL   Submitted (16-FEB-2007) to the INSDC.
RL   Dubois V., Hla Laboratory, Efs Rhone Alpes, 1 et 3 rue du vercors, 69007
RL   Lyon, FRANCE.
RN   [2]
RA   Dubois V., Favre Victoire I., Giannoli C., Moine A.;
RT   "New HLA class I alleles found by routinely SBT method";
RL   Unpublished.
DR   MD5; 21572ab004fbac53497c9ac93bafca56.
FH   Key             Location/Qualifiers
FT   source          1..822
FT                   /organism="Homo sapiens"
FT                   /mol_type="genomic DNA"
FT                   /sex="male"
FT                   /PCR_primers="fwd_name: Leu T11, fwd_seq:
FT                   aaccctcctcctgctactctt, rev_name: P3'intron 6A, rev_seq:
FT                   cccacagaasatgtggctag"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..>822
FT                   /codon_start=3
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*29"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:A*29:18"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:A2VBZ8"
FT                   /protein_id="CAM35421.1"
SQ   Sequence 822 BP; 165 A; 245 C; 288 G; 124 T; 0 other;
     gctcccactc catgaggtat ttcaccacat ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc cgtgggctac gtggacgaca cgcagttcgt gcggtttgac agcgacgccg       120
     cgagccagag gatggagccg cgggcgccgt ggatagagca ggaggggccg gagtattggg       180
     accaggagac acggaatgtg aaggcccagt cacagactga ccgagcgaac ctggggaccc       240
     tgcgcggcta ctacaaccag agcgaggccg gttctcacac catccagatg atgtatggct       300
     gcgacgtggg gtcggacggg cgcttcctcc gcgggtaccg gcaggacgcc tacgacggca       360
     aggattacat cgccttgaac gaggacctgc gctcttggac cgcggcggac atggcggctc       420
     agatcaccca gcgcaagtgg gaggcggccc gtgtggcgga gcagttgaga gcctacctgg       480
     agggcacgtg cgtggagtgg ctccgcagat acctggagaa cgggaaggag acgctgcagc       540
     gcacggacgc ccccaagacg catatgactc accacgctgt ctctgaccat gaggccaccc       600
     tgaggtgctg ggccctgagc ttctaccctg cggagatcac actgacctgg cagcgggatg       660
     gggaggacca gacccaggac acggagcttg tggagaccag gcctgcaggg gatggaacct       720
     tccagaagtg ggcgtctgtg gtggtgcctt ctggacagga gcagagatac acctgccatg       780
     tgcagcatga gggtctgccc aagcccctca ccctgagatg gg                          822