
ID   AM491588; SV 1; linear; genomic DNA; STD; HUM; 1800 BP.
AC   AM491588;
DT   06-FEB-2007 (Rel. 90, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-B gene for MHC class I antigen, HLA-B*15new
DE   allele, exons 1-5
KW   HLA-B gene; HLA-B*15new allele; human leucocyte B;
KW   major histocompatibility complex; MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1800
RA   Dormoy A.;
RT   ;
RL   Submitted (05-FEB-2007) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Soreau E., Froelich N., Leisenbach R.;
RT   "The HLA-B*15 new allele is identical to the current HLA-B*15010101 allele
RT   except a substitution at position 409 leading to the change of the amino
RT   acid 113: CAT(His) ->TAT (Tyr)";
RL   Unpublished.
DR   MD5; 607ae6e273e70cf92a446e3fe914fb27.
FH   Key             Location/Qualifiers
FT   source          1..1800
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: P5' Gly A-10, fwd_seq:
FT                   cctcctgctgctctcggga, rev_name: P3' exon 5B, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..29,159..428,674..949,1361..1636,1741..>1800)
FT                   /codon_start=2
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:B*15:128"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR036179"
FT                   /db_xref="InterPro:IPR037055"
FT                   /db_xref="UniProtKB/TrEMBL:A2RQE1"
FT                   /protein_id="CAM33242.1"
FT   exon            <1..29
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15new"
FT                   /number=1
FT   intron          30..158
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15new"
FT                   /number=1
FT   exon            159..428
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15new"
FT                   /number=2
FT   intron          429..673
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15new"
FT                   /number=2
FT   exon            674..949
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15new"
FT                   /number=3
FT   intron          950..1360
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15new"
FT                   /number=3
FT   exon            1361..1636
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15new"
FT                   /number=4
FT   intron          1637..1740
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15new"
FT                   /number=4
FT   exon            1741..>1800
FT                   /gene="HLA-B"
FT                   /allele="HLA-B*15new"
FT                   /number=5
SQ   Sequence 1800 BP; 341 A; 562 C; 598 G; 299 T; 0 other;
     agccctggcc ctgaccgaga cctgggccgg tgagtgcggg gtcggcaggg aaatggcctc        60
     tgtggggagg agcgagggga ccgcaggcgg gggcgcagga cccggggagc cgcgcaggga       120
     ggagggtcgg gcgggtctca gcccctcctc gcccccaggc tcccactcca tgaggtattt       180
     ctacaccgcc atgtcccggc ccggccgcgg ggagccccgc ttcatcgcag tgggctacgt       240
     ggacgacacc cagttcgtga ggttcgacag cgacgccgcg agtccgagga tggcgccccg       300
     ggcgccatgg atagagcagg aggggccgga gtattgggac cgggagacac agatctccaa       360
     gaccaacaca cagacttacc gagagagcct gcggaacctg cgcggctact acaaccagag       420
     cgaggccggt gagtgacccc ggcctggggc gcaggtcacg actccccatc ccccacgtac       480
     ggcccgggtc gccccgagtc tccgggtccg agatccgccc ccctgaggcc gcgggacccg       540
     cccaaaccct cgaccggcga gagccccagg cgcgtttacc cggtttcatt ttcagttgag       600
     gccaaaatcc ccgcgggttg gtcggggcgg ggcggggctc gggggacggg gctgaccgcg       660
     gggcctgggc cagggtctca caccctccag aggatgtacg gctgcgacgt ggggccggac       720
     gggcgcctcc tccgcgggta tgaccagtcc gcctacgacg gcaaggatta catcgccctg       780
     aacgaggacc tgagctcctg gaccgcggcg gacacggcgg ctcagatcac ccagcgcaag       840
     tgggaggcgg cccgtgaggc ggagcagtgg agagcctacc tggagggcct gtgcgtggag       900
     tggctccgca gatacctgga gaacgggaag gagacgctgc agcgcgcggg taccaggggc       960
     agtggggagc cttccccatc tcctataggt cgccggggat ggcctcccac gagaagagga      1020
     ggaaaatggg atcagcgcta gaatgtcgcc ctcccttgaa tggagaatgg catgagtttt      1080
     cctgagtttc ctctgagggc cccctcttct ctctaggaca attaagggat gacgtctctg      1140
     aggaaatgga ggggaagaca gtccctagga tagtgatcag gggtcccctt tgacccctgc      1200
     agcagccttg ggaaccgtga cttttcctct caggccttgt tctctgcctc acactcacca      1260
     ccccaggtgt cctgtccatt ctcaggctgg tcacatgggt ggtcctaggg tgtcccatga      1320
     gagatgcaaa gcgcctgaat tttctgactc ttcccatcag accccccaaa gacacatgtg      1380
     acccaccacc ccatctctga ccatgaggcc accctgaggt gctgggccct gggcttctac      1440
     cctgcggaga tcacactgac ctggcagcgg gatggcgagg accaaactca ggacaccgag      1500
     cttgtggaga ccagaccagc aggagataga accttccaga agtgggcagc tgtggtggtg      1560
     ccttctggag aagagcagag atacacatgc catgtacagc atgaggggct gccgaagccc      1620
     ctcaccctga gatggggtaa ggagggggat gaggggtcat atctgttctc agggaaagca      1680
     ggagcccttc tggagccctt cagcagggtc agggcccctc atcttcccct cctttcccag      1740
     agccatcttc ccagtccacc atccccatcg tgggcattgt tgctggcctg gctgtcctag      1800