
ID   AM419012; SV 1; linear; genomic DNA; STD; HUM; 842 BP.
AC   AM419012;
DT   11-DEC-2006 (Rel. 90, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-Cw gene for MHC class I antigen, HLA-Cw*0205 new
DE   variant allele, exons 2-3
KW   HLA-Cw gene; HLA-Cw*0205 allele; major histocompatibility complex;
KW   MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-842
RA   Minevich G.;
RT   ;
RL   Submitted (08-DEC-2006) to the INSDC.
RL   Minevich G., Pediatrics, Columbia University, 630 W 168th St. Black
RL   Building room 448, NY, 10032, USA.
RN   [2]
RA   Minevich G., Nuara J., Kuhn L., Winchester R.;
RT   "Description of two new HLA-Cw alleles in a South African population";
RL   Unpublished.
DR   MD5; f28220912b7988680e2fd881edaf8d8d.
FH   Key             Location/Qualifiers
FT   source          1..842
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21"
FT                   /mol_type="genomic DNA"
FT                   /country="South Africa"
FT                   /collection_date="10-Sep-1997"
FT                   /haplotype="B*5801-Cw*0205new"
FT                   /clone="TOPO TA clone 11"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: Petersdorf_Outer_C1_5'G, fwd_seq:
FT                   agcgaggggcccgcccggcga, rev_name: Petersdorf_Outer_C2_3',
FT                   rev_seq: ggagatggggaaggctccccact"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<20..289,535..>810)
FT                   /codon_start=3
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0205 new variant"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /note="new allele present in proband and mother of proband
FT                   in haplotype containing HLA-B*5801. Also present in a third
FT                   person from the same population in haplotype containing
FT                   HLA-B*080101"
FT                   /db_xref="GOA:A0ZY50"
FT                   /db_xref="IMGT/HLA:C*02:17"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:A0ZY50"
FT                   /protein_id="CAL91416.1"
FT                   VEWLRRYLENGKETLQRA"
FT   exon            <20..289
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0205 new variant"
FT                   /number=2
FT   intron          290..534
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0205 new variant"
FT                   /number=2
FT   exon            535..>810
FT                   /gene="HLA-Cw"
FT                   /allele="HLA-Cw*0205 new variant"
FT                   /number=3
SQ   Sequence 842 BP; 150 A; 280 C; 297 G; 115 T; 0 other;
     agcccctcct ctcccccagg ctcccactcc atgaggtatt tctacaccgc tgtgtcccgg        60
     cccagccgcg gagagcccca cttcatcgca gtgggctacg tggacgacac gcagttcgtg       120
     cggttcgaca gcgacgccgc gagtccaaga ggggagccgc gggcgccgtg ggtggagcag       180
     gaggggccgg agtattggga ccgggagaca cagaagtaca agcgccaggc acagactgac       240
     cgagtgaacc tgcggaaact gcgcggctac tacaaccaga gcgaggccgg tgagtgaccc       300
     cggcccgggg cgcaggtcac gacccctccc catcccccac ggacggcccg ggtcgccccg       360
     agtctccggg tctgagatcc accccgaggc tgcggaaccc gcccagaccc tcgaccggag       420
     agagccccag tcacctttac ccggtttcat tttcagttta ggccaaaatc cccgcgggtt       480
     ggtcggggct ggggcggggc tcgggggacg ggctgaccac gggggcgggg ccagggtctc       540
     acaccctcca gtggatgttt ggctgcgacc tggggcccga cgggcgcctc ctccgcgggt       600
     atgaccagtc cgcctacgac ggcaaggatt acatcgccct gaacgaggac ctgcgctcct       660
     ggaccgccgc ggacacggcg gctcagatca cccagcgcaa gtgggaggcg gcccgtgagg       720
     cggagcagtg gagagcctac ctggagggcg agtgcgtgga gtggctccgc agatacctgg       780
     agaacgggaa ggagacgctg cagcgcgcgg gtaccagggg cagtggggag ccttccccat       840
     ct                                                                      842