
EBI Dbfetch

ID   AM413002; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   AM413002;
DT   04-DEC-2006 (Rel. 90, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-DRB3 gene for MHC class II antigen HLA-DR52,
DE   HLA-DRB3*new allele, exon 2
KW   HLA-DRB3 gene; HLA-DRB3*new allele; human leucocyte antigen DRB3;
KW   major histocompatibility complex; MHC class II antigen HLA-DR52.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RA   Dormoy A.;
RT   ;
RL   Submitted (27-NOV-2006) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Froelich N.;
RT   "The DRB3 new allele is identical to the current HLA-DRB3*020201 allele
RT   except a point substitution at codon 74 where a G is found in place of A";
RL   Unpublished.
DR   MD5; fafcf5b4bab2c30ee0493a72742b3fd9.
DR   Ensembl-Gn; ENSG00000196101; homo_sapiens.
DR   Ensembl-Gn; ENSG00000230463; homo_sapiens.
DR   Ensembl-Gn; ENSG00000231679; homo_sapiens.
DR   Ensembl-Tr; ENST00000307137; homo_sapiens.
DR   Ensembl-Tr; ENST00000383126; homo_sapiens.
DR   Ensembl-Tr; ENST00000426847; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: P5' DRB3_intron 1, fwd_seq:
FT                   ccccgttcgcctsaggaaa, rev_name: P3' intron 2DRB3_revM13,
FT                   rev_seq: caggaaacagctatgaccatttccagctcacagggacc"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DRB3"
FT                   /allele="HLA-DRB3*new"
FT                   /product="MHC class II antigen HLA-DR52"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:P79483"
FT                   /db_xref="HGNC:HGNC:4951"
FT                   /db_xref="IMGT/HLA:DRB3*02:22"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="PDB:2Q6W"
FT                   /db_xref="PDB:3C5J"
FT                   /db_xref="PDB:4H1L"
FT                   /db_xref="UniProtKB/Swiss-Prot:P79483"
FT                   /protein_id="CAL85628.1"
FT   exon            1..270
FT                   /gene="HLA-DRB3"
FT                   /allele="HLA-DRB3*new"
FT   variation       208
FT                   /gene="HLA-DRB3"
FT                   /allele="HLA-DRB3*020201"
FT                   /replace="a"
FT                   /compare=AF152845.1
FT                   /note="Arg to Gln"
SQ   Sequence 270 BP; 58 A; 62 C; 101 G; 49 T; 0 other;
     cacgtttctt ggagctgctt aagtctgagt gtcatttctt caatgggacg gagcgggtgc        60
     ggttcctgga gagacacttc cataaccagg aggagtacgc gcgcttcgac agcgacgtgg       120
     gggagtaccg ggcggtgagg gagctggggc ggcctgatgc cgagtactgg aacagccaga       180
     aggacctcct ggagcagaag cggggccggg tggacaatta ctgcagacac aactacgggg       240
     ttggtgagag cttcacagtg cagcggcgag                                        270
