
ID   AM413001; SV 1; linear; genomic DNA; STD; HUM; 995 BP.
AC   AM413001;
DT   04-DEC-2006 (Rel. 90, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-A gene for MHC class I antigen, HLA-A*03new
DE   allele, exons 2-4
KW   HLA-A gene; HLA-A*03new allele; human leucocyte antigen A;
KW   major histocompatibility complex; MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-995
RA   Dormoy A.;
RT   ;
RL   Submitted (27-NOV-2006) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Froelich N.;
RT   "The HLA-A*03 new allele is identical to the A*03010101 current allele
RT   except a deletion of 27 nucleotides leading to a change in reading frame.";
RL   Unpublished.
DR   MD5; 608114ebdef5c68afd4269823460541e.
FH   Key             Location/Qualifiers
FT   source          1..995
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_name: P5' intron 1A(C93), fwd_seq:
FT                   ggagccgcgccgggac, rev_name: P3' intron 4A, rev_seq:
FT                   ggaaggtgaggggccctga"
FT                   /db_xref="taxon:9606"
FT   CDS             join(<1..243,344..619,720..>995)
FT                   /codon_start=3
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*03new"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="IMGT/HLA:A*03:36N"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="UniProtKB/TrEMBL:A0ZXY8"
FT                   /protein_id="CAL85627.1"
FT   exon            1..243
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*03new"
FT                   /number=2
FT   variation       190^191
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*03010101"
FT                   /replace="acggaatgtgaaggcccagtcacagac"
FT                   /compare=U32184.1
FT   gap             244..343
FT                   /estimated_length=unknown
FT   exon            344..619
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*03new"
FT                   /number=3
FT   gap             620..719
FT                   /estimated_length=unknown
FT   exon            720..995
FT                   /gene="HLA-A"
FT                   /allele="HLA-A*03new"
FT                   /number=4
SQ   Sequence 995 BP; 159 A; 241 C; 277 G; 118 T; 200 other;
     gctcccactc catgaggtat ttcttcacat ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatcgc cgtgggctac gtggacgaca cgcagttcgt gcggttcgac agcgacgccg       120
     cgagccagag gatggagccg cgggcgccgt ggatagagca ggaggggccg gagtattggg       180
     accaggagac tgaccgagtg gacctgggga ccctgcgcgg ctactacaac cagagcgagg       240
     ccgnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnngttctca caccatccag       360
     ataatgtatg gctgcgacgt ggggtcggac gggcgcttcc tccgcgggta ccggcaggac       420
     gcctacgacg gcaaggatta catcgccctg aacgaggacc tgcgctcttg gaccgcggcg       480
     gacatggcgg ctcagatcac caagcgcaag tgggaggcgg cccatgaggc ggagcagttg       540
     agagcctacc tggatggcac gtgcgtggag tggctccgca gatacctgga gaacgggaag       600
     gagacgctgc agcgcacggn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       660
     nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnna       720
     cccccccaag acacatatga cccaccaccc catctctgac catgaggcca ccctgaggtg       780
     ctgggccctg ggcttctacc ctgcggagat cacactgacc tggcagcggg atggggagga       840
     ccagacccag gacacggagc tcgtggagac caggcctgca ggggatggaa ccttccagaa       900
     gtgggcggct gtggtggtgc cttctggaga ggagcagaga tacacctgcc atgtgcagca       960
     tgagggtctg cccaagcccc tcaccctgag atggg                                  995