
ID   AM411359; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   AM411359;
DT   14-DEC-2006 (Rel. 90, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens HLA-DRB1 gene for MHC Class II antigen, HLA-DRB1*07new allele,
DE   exon 2
KW   HLA-DRB1 gene; HLA-DRB1*07new allele; human leucocyte antigen DRB1;
KW   major histocompatibility complex; MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RA   McWhinnie A.J.M.;
RT   ;
RL   Submitted (14-NOV-2006) to the INSDC.
RL   McWhinnie A.J.M., Anthony Nolan Trust, Anthony Nolan Research Institute,
RL   Fleet Road, Hampstead, London, NW3 2QG, UNITED KINGDOM.
RN   [2]
RA   McWhinnie A.J.M.;
RT   "Exon 2 sequence of a new HLA-DRB1*07 allele DRB1*07XX.";
RL   Unpublished.
DR   MD5; 4a47467d56234b6901901a8a9347a188.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /map="6p21.3"
FT                   /mol_type="genomic DNA"
FT                   /country="United Kingdom"
FT                   /tissue_type="peripheral blood"
FT                   /PCR_primers="fwd_name: 5DRX2PCR1, fwd_seq:
FT                   ggttcccagtgcccgcaccct, rev_name: 3DRX2PCR3, rev_seq:
FT                   acaaccacactcagattccca"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*07new"
FT                   /product="MHC class II antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:A0ZXX2"
FT                   /db_xref="IMGT/HLA:DRB1*07:12"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:A0ZXX2"
FT                   /protein_id="CAL69598.1"
FT   exon            1..270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*07new"
FT                   /number=2
SQ   Sequence 270 BP; 59 A; 63 C; 99 G; 49 T; 0 other;
     cacgtttcct gtggcagggt aagtataagt gtcatttctt caacgggacg gagcgggtgc        60
     agttcctgga aagactcttc tataaccagg aggagttcgt gcgcttcgac agcgacgtgg       120
     gggagtaccg ggcggtgacg gagctagggc ggcctatcgc cgagtcctgg aacagccaga       180
     aggacatcct ggaggacagg cggggccagg tggacaccgt gtgcagacac aactacgggg       240
     ttggtgagag cttcacagtg cagcggcgag                                        270