
EBI Dbfetch

ID   AM410992; SV 1; linear; genomic DNA; STD; HUM; 270 BP.
AC   AM410992;
DT   22-NOV-2006 (Rel. 89, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-DRB1 gene for MHC class II antigen, allele
DE   HLA-DRB1*030101new, exon 2
KW   HLA-DRB1 gene; HLA-DRB1*030101new allele; human leucocyte antigen DRB1;
KW   major histocompatibility complex; MHC class II antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-270
RA   Avinens O.;
RT   ;
RL   Submitted (10-NOV-2006) to the INSDC.
RL   Avinens O., Hopital Saint Eloi, Laboratoire Immunologie, 80 avenue Augustin
RL   Fliche, 34295 Montpellier Cedex 5, FRANCE.
RN   [2]
RA   Avinens O., Eliaou J.F.;
RT   "New allele for DRB1";
RL   Unpublished.
DR   MD5; 5362e001427f5e29734b798778883431.
DR   Ensembl-Gn; ENSG00000206240; homo_sapiens.
DR   Ensembl-Gn; ENSG00000206306; homo_sapiens.
DR   Ensembl-Tr; ENST00000328980; homo_sapiens.
DR   Ensembl-Tr; ENST00000399450; homo_sapiens.
DR   Ensembl-Tr; ENST00000415796; homo_sapiens.
DR   Ensembl-Tr; ENST00000428566; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..270
FT                   /organism="Homo sapiens"
FT                   /chromosome="6"
FT                   /mol_type="genomic DNA"
FT                   /tissue_type="blood"
FT                   /PCR_primers="fwd_name: I1RB5, fwd_seq:
FT                   agcactaaggaagggttcag, rev_name: I2RB28, rev_seq:
FT                   tgggaatctgagtgtgtgtgt"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..>270
FT                   /codon_start=3
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*030101new"
FT                   /product="MHC class II antigen"
FT                   /db_xref="GOA:A0PFK3"
FT                   /db_xref="IMGT/HLA:DRB1*03:01:03"
FT                   /db_xref="InterPro:IPR000353"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR014745"
FT                   /db_xref="UniProtKB/TrEMBL:A0PFK3"
FT                   /protein_id="CAL69969.1"
FT   exon            1..270
FT                   /gene="HLA-DRB1"
FT                   /allele="HLA-DRB1*030101new"
FT                   /number=2
SQ   Sequence 270 BP; 59 A; 63 C; 98 G; 50 T; 0 other;
     cacgtttctt ggagtactct acgtctgagt gtcatttctt taatgggacg gagcgggtgc        60
     ggtacctgga cagatacttc cataaccagg aggagaacgt gcgcttcgac agcgacgtgg       120
     gggagttccg ggcggtgacg gagctggggc ggcctgatgc cgagtactgg aacagccaga       180
     aggacctcct ggagcagaag cggggccggg tggacaacta ctgcagacac aactacgggg       240
     ttgtggagag cttcacagtg cagcggcgag                                        270
