
EBI Dbfetch

ID   AM236599; SV 1; linear; genomic DNA; STD; HUM; 822 BP.
AC   AM236599;
DT   22-MAR-2006 (Rel. 87, Created)
DT   17-JUN-2008 (Rel. 96, Last updated, Version 2)
DE   Homo sapiens partial HLA-B gene for MHC class 1 antigen, exons 2-4,
DE   HLA-B*07null allele.
KW   HLA-B gene; HLA-B*07null allele; human leucocyte antigen B;
KW   major histocompatibility complex; MHC class I antigen.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-822
RA   Dormoy A.;
RT   ;
RL   Submitted (21-MAR-2006) to the INSDC.
RL   Dormoy A., Laboratoire HLA, Etablissement Francais du Sang - Alsace, 10 rue
RL   Spielmann, 67000, FRANCE.
RN   [2]
RA   Dormoy A., Weschler B., Froelich N., Perrier P.;
RT   "The HLA-B*07null allele is identical to the B*070201 current allele except
RT   a mutation at position 893 in exon 4(G->A)leading to a STOP codon";
RL   Unpublished.
DR   MD5; a78f1b5d15e3732899c2c4a3ec92fdeb.
DR   Ensembl-Gn; ENSG00000234745; homo_sapiens.
DR   Ensembl-Tr; ENST00000412585; homo_sapiens.
FH   Key             Location/Qualifiers
FT   source          1..822
FT                   /organism="Homo sapiens"
FT                   /map="6"
FT                   /mol_type="genomic DNA"
FT                   /PCR_primers="fwd_seq: gaggatgctggtcatggcg, rev_seq:
FT                   gctccgatgaccacaactgct"
FT                   /db_xref="taxon:9606"
FT   CDS             <1..821
FT                   /codon_start=3
FT                   /gene="HLA-B*"
FT                   /allele="HLA-B*07null"
FT                   /product="MHC class I antigen"
FT                   /function="antigen presenting molecule"
FT                   /db_xref="GOA:Q256S0"
FT                   /db_xref="IMGT/HLA:B*07:49N"
FT                   /db_xref="InterPro:IPR001039"
FT                   /db_xref="InterPro:IPR003006"
FT                   /db_xref="InterPro:IPR003597"
FT                   /db_xref="InterPro:IPR007110"
FT                   /db_xref="InterPro:IPR011161"
FT                   /db_xref="InterPro:IPR011162"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR027648"
FT                   /db_xref="UniProtKB/TrEMBL:Q256S0"
FT                   /protein_id="CAJ85792.1"
SQ   Sequence 822 BP; 180 A; 255 C; 275 G; 112 T; 0 other;
     gctcccactc catgaggtat ttctacacct ccgtgtcccg gcccggccgc ggggagcccc        60
     gcttcatctc agtgggctac gtggacgaca cccagttcgt gaggttcgac agcgacgccg       120
     cgagtccgag agaggagccg cgggcgccgt ggatagagca ggaggggccg gagtattggg       180
     accggaacac acagatctac aaggcccagg cacagactga ccgagagagc ctgcggaacc       240
     tgcgcggcta ctacaaccag agcgaggccg ggtctcacac cctccagagc atgtacggct       300
     gcgacgtggg gccggacggg cgcctcctcc gcgggcatga ccagtacgcc tacgacggca       360
     aggattacat cgccctgaac gaggacctgc gctcctggac cgccgcggac acggcggctc       420
     agatcaccca gcgcaagtgg gaggcggccc gtgaggcgga gcagcggaga gcctacctgg       480
     agggcgagtg cgtggagtgg ctccgcagat acctggagaa cgggaaggac aagctggagc       540
     gcgctgaccc cccaaagaca cacgtgaccc accaccccat ctctgaccat gaggccaccc       600
     tgaggtgctg ggccctgggt ttctaccctg cggagatcac actgacctgg cagcgggatg       660
     gcgaggacca aactcaggac actgagcttg tggagaccag accagcagga gatagaacct       720
     tccagaagtg ggcagctgtg gtggtgcctt ctggagaaga gcagagatac acatgccatg       780
     tacagcatga ggggctgccg aagcccctca ccctgagata gg                          822
